|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for RPL5 |
 Gene summary |
| Gene information | Gene symbol | RPL5 | Gene ID | 6125 |
| Gene name | ribosomal protein L5 | |
| Synonyms | L5|MSTP030|PPP1R135|uL18 | |
| Cytomap | 1p22.1 | |
| Type of gene | protein-coding | |
| Description | 60S ribosomal protein L5large ribosomal subunit protein uL18protein phosphatase 1, regulatory subunit 135 | |
| Modification date | 20180523 | |
| UniProtAcc | P46777 | |
| Context | PubMed: RPL5 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| RPL5 | GO:0010628 | positive regulation of gene expression | 18560357 |
| RPL5 | GO:0045727 | positive regulation of translation | 16213212 |
| RPL5 | GO:1904667 | negative regulation of ubiquitin protein ligase activity | 18560357 |
| RPL5 | GO:2000059 | negative regulation of ubiquitin-dependent protein catabolic process | 18560357 |
| RPL5 | GO:2000435 | negative regulation of protein neddylation | 18560357 |
Top |
Exon skipping events across known transcript of Ensembl for RPL5 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for RPL5 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for RPL5 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_7843 | 1 | 93297654:93297674:93298945:93299015:93299101:93299217 | 93298945:93299015 | ENSG00000122406.8 | ENST00000470843.1 |
| exon_skip_7876 | 1 | 93299101:93299217:93300335:93300470:93301746:93301828 | 93300335:93300470 | ENSG00000122406.8 | ENST00000370321.3,ENST00000315741.5,ENST00000461952.1 |
| exon_skip_7894 | 1 | 93300335:93300470:93301746:93301949:93303012:93303026 | 93301746:93301949 | ENSG00000122406.8 | ENST00000370321.3,ENST00000315741.5 |
| exon_skip_7908 | 1 | 93301746:93301949:93303012:93303190:93306107:93306196 | 93303012:93303190 | ENSG00000122406.8 | ENST00000370321.3 |
| exon_skip_7918 | 1 | 93303012:93303190:93306107:93306196:93307322:93307419 | 93306107:93306196 | ENSG00000122406.8 | ENST00000497519.1,ENST00000370321.3 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for RPL5 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_7843 | 1 | 93297654:93297674:93298945:93299015:93299101:93299217 | 93298945:93299015 | ENSG00000122406.8 | ENST00000470843.1 |
| exon_skip_7874 | 1 | 93299146:93299217:93299352:93299506:93300335:93300470 | 93299352:93299506 | ENSG00000122406.8 | ENST00000470843.1 |
| exon_skip_7876 | 1 | 93299101:93299217:93300335:93300470:93301746:93301828 | 93300335:93300470 | ENSG00000122406.8 | ENST00000370321.3,ENST00000315741.5,ENST00000461952.1 |
| exon_skip_7894 | 1 | 93300335:93300470:93301746:93301949:93303012:93303026 | 93301746:93301949 | ENSG00000122406.8 | ENST00000370321.3,ENST00000315741.5 |
| exon_skip_7908 | 1 | 93301746:93301949:93303012:93303190:93306107:93306196 | 93303012:93303190 | ENSG00000122406.8 | ENST00000370321.3 |
| exon_skip_7918 | 1 | 93303012:93303190:93306107:93306196:93307322:93307419 | 93306107:93306196 | ENSG00000122406.8 | ENST00000370321.3,ENST00000497519.1 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for RPL5 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000370321 | 93301746 | 93301949 | Frame-shift |
| ENST00000370321 | 93303012 | 93303190 | Frame-shift |
| ENST00000370321 | 93306107 | 93306196 | Frame-shift |
| ENST00000370321 | 93300335 | 93300470 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000370321 | 93301746 | 93301949 | Frame-shift |
| ENST00000370321 | 93303012 | 93303190 | Frame-shift |
| ENST00000370321 | 93306107 | 93306196 | Frame-shift |
| ENST00000370321 | 93300335 | 93300470 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for RPL5 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000370321 | 1060 | 297 | 93300335 | 93300470 | 280 | 414 | 63 | 108 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000370321 | 1060 | 297 | 93300335 | 93300470 | 280 | 414 | 63 | 108 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| P46777 | 63 | 108 | 2 | 297 | Chain | ID=PRO_0000131431;Note=60S ribosomal protein L5 |
| P46777 | 63 | 108 | 78 | 78 | Sequence conflict | Note=A->R;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| P46777 | 63 | 108 | 2 | 297 | Chain | ID=PRO_0000131431;Note=60S ribosomal protein L5 |
| P46777 | 63 | 108 | 78 | 78 | Sequence conflict | Note=A->R;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
Top |
SNVs in the skipped exons for RPL5 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
RPL5_SKCM_exon_skip_7843_psi_boxplot.png |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| GBM | TCGA-06-5413-01 | exon_skip_7843 | 93298946 | 93299015 | 93298955 | 93298955 | Frame_Shift_Del | A | - | p.K5fs |
| SKCM | TCGA-EE-A2GI-06 | exon_skip_7894 | 93301747 | 93301949 | 93301759 | 93301759 | Frame_Shift_Del | T | - | p.F113fs |
| SKCM | TCGA-EE-A2GI-06 | exon_skip_7894 | 93301747 | 93301949 | 93301759 | 93301759 | Frame_Shift_Del | T | - | p.R112fs |
| LUAD | TCGA-97-8177-01 | exon_skip_7894 | 93301747 | 93301949 | 93301834 | 93301837 | Frame_Shift_Del | CAGC | - | p.QP138fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_7908 | 93303013 | 93303190 | 93303017 | 93303017 | Frame_Shift_Del | A | - | p.K178fs |
| TGCT | TCGA-2G-AAFH-01 | exon_skip_7876 | 93300336 | 93300470 | 93300360 | 93300361 | Frame_Shift_Ins | - | AT | p.Y72fs |
| GBM | TCGA-06-0216-01 | exon_skip_7894 | 93301747 | 93301949 | 93301897 | 93301898 | Frame_Shift_Ins | - | T | p.V159fs |
| SKCM | TCGA-ER-A19G-06 | exon_skip_7843 | 93298946 | 93299015 | 93298955 | 93298955 | Nonsense_Mutation | A | T | p.K5* |
| SKCM | TCGA-ER-A19G-06 | exon_skip_7843 | 93298946 | 93299015 | 93298955 | 93298955 | Nonsense_Mutation | A | T | p.K5X |
| GBM | TCGA-26-6174-01 | exon_skip_7843 | 93298946 | 93299015 | 93298990 | 93298990 | Nonsense_Mutation | C | A | p.Y16* |
| BLCA | TCGA-XF-AAMY-01 | exon_skip_7894 | 93301747 | 93301949 | 93301834 | 93301834 | Nonsense_Mutation | C | T | p.Q138* |
| SKCM | TCGA-GN-A4U4-06 | exon_skip_7908 | 93303013 | 93303190 | 93303020 | 93303020 | Nonsense_Mutation | C | T | p.R179* |
| LUAD | TCGA-49-6742-01 | exon_skip_7918 | 93306108 | 93306196 | 93306114 | 93306114 | Nonsense_Mutation | G | T | p.E238* |
| BLCA | TCGA-GV-A3QF-01 | exon_skip_7876 | 93300336 | 93300470 | 93300335 | 93300335 | Splice_Site | G | A | p.I64_splice |
| GBM | TCGA-06-0154-01 | exon_skip_7894 | 93301747 | 93301949 | 93301746 | 93301746 | Splice_Site | G | C | p.L109_splice |
| LUAD | TCGA-75-7030-01 | exon_skip_7918 | 93306108 | 93306196 | 93306107 | 93306107 | Splice_Site | G | T | p.M236_splice |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
 | Sample: TCGA-ER-A19G-06 |
| Cancer type: SKCM | |
| ESID: exon_skip_7843 | |
| Skipped exon start: 93298946 | |
| Skipped exon end: 93299015 | |
| Mutation start: 93298955 | |
| Mutation end: 93298955 | |
| Mutation type: Nonsense_Mutation | |
| Reference seq: A | |
| Mutation seq: T | |
| AAchange: p.K5X | |
| Sample: TCGA-ER-A19G-06 |
| Cancer type: SKCM | |
| ESID: exon_skip_7843 | |
| Skipped exon start: 93298946 | |
| Skipped exon end: 93299015 | |
| Mutation start: 93298955 | |
| Mutation end: 93298955 | |
| Mutation type: Nonsense_Mutation | |
| Reference seq: A | |
| Mutation seq: T | |
| AAchange: p.K5* | |
exon_skip_290191_SKCM_TCGA-ER-A19G-06.png | |
exon_skip_7843_SKCM_TCGA-ER-A19G-06.png | |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| SKMEL24_SKIN | 93300336 | 93300470 | 93300381 | 93300400 | Frame_Shift_Del | TATGCACACGAACTGCCAAA | - | p.YAHELPK79fs |
| UACC257_SKIN | 93300336 | 93300470 | 93300421 | 93300427 | Frame_Shift_Del | TGACAAA | - | p.LTN92fs |
| JHOC5_OVARY | 93301747 | 93301949 | 93301780 | 93301783 | Frame_Shift_Del | GAAG | - | p.EG120fs |
| DND41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 93298946 | 93299015 | 93299008 | 93299009 | Frame_Shift_Ins | - | CGTCCCATGC | p.-23fs |
| HPAC_PANCREAS | 93306108 | 93306196 | 93306110 | 93306112 | In_Frame_Del | GGA | - | p.E238del |
| CP67MEL_SKIN | 93298946 | 93299015 | 93298955 | 93298955 | Missense_Mutation | A | G | p.K5E |
| SNU1041_UPPER_AERODIGESTIVE_TRACT | 93298946 | 93299015 | 93298967 | 93298967 | Missense_Mutation | A | C | p.N9H |
| CTV1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 93300336 | 93300470 | 93300348 | 93300348 | Missense_Mutation | C | T | p.R68C |
| SNU1040_LARGE_INTESTINE | 93300336 | 93300470 | 93300375 | 93300375 | Missense_Mutation | G | A | p.A77T |
| SNU81_LARGE_INTESTINE | 93300336 | 93300470 | 93300375 | 93300375 | Missense_Mutation | G | A | p.A77T |
| KYM1_SOFT_TISSUE | 93300336 | 93300470 | 93300403 | 93300403 | Missense_Mutation | A | G | p.Y86C |
| KNS81_CENTRAL_NERVOUS_SYSTEM | 93300336 | 93300470 | 93300445 | 93300445 | Missense_Mutation | G | A | p.C100Y |
| KNS81FD_CENTRAL_NERVOUS_SYSTEM | 93300336 | 93300470 | 93300445 | 93300445 | Missense_Mutation | G | A | p.C100Y |
| BICR56_UPPER_AERODIGESTIVE_TRACT | 93301747 | 93301949 | 93301888 | 93301888 | Missense_Mutation | G | A | p.G156S |
| LS180_LARGE_INTESTINE | 93301747 | 93301949 | 93301940 | 93301940 | Missense_Mutation | T | C | p.I173T |
| MCC13_SKIN | 93303013 | 93303190 | 93303026 | 93303027 | Missense_Mutation | CC | TA | p.P181Y |
| MCC13_SKIN | 93303013 | 93303190 | 93303026 | 93303026 | Missense_Mutation | C | T | p.P181S |
| MCC13_SKIN | 93303013 | 93303190 | 93303027 | 93303027 | Missense_Mutation | C | A | p.P181H |
| SNU466_CENTRAL_NERVOUS_SYSTEM | 93303013 | 93303190 | 93303104 | 93303104 | Missense_Mutation | T | A | p.Y207N |
| SNU1040_LARGE_INTESTINE | 93303013 | 93303190 | 93303111 | 93303111 | Missense_Mutation | G | A | p.R209H |
| BICR18_UPPER_AERODIGESTIVE_TRACT | 93303013 | 93303190 | 93303174 | 93303174 | Missense_Mutation | G | A | p.S230N |
| HCC2998_LARGE_INTESTINE | 93306108 | 93306196 | 93306149 | 93306149 | Missense_Mutation | G | T | p.E249D |
| HCC2998_LARGE_INTESTINE | 93306108 | 93306196 | 93306181 | 93306181 | Missense_Mutation | A | G | p.E260G |
| SUPB15_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 93301747 | 93301949 | 93301786 | 93301786 | Nonsense_Mutation | C | T | p.Q122* |
| MET2B | 93306108 | 93306196 | 93306122 | 93306122 | Nonsense_Mutation | T | A | p.Y240* |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for RPL5 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for RPL5 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for RPL5 |
Top |
RelatedDrugs for RPL5 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for RPL5 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| RPL5 | C2931850 | Aase Smith syndrome 2 | 2 | CTD_human;UNIPROT |
| RPL5 | C0029927 | Ovarian Cysts | 1 | CTD_human |
| RPL5 | C1961099 | Precursor T-Cell Lymphoblastic Leukemia-Lymphoma | 1 | CTD_human |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|