ExonSkipDB: functional annotation of exon skipping event in human

Gene summary for SENP2

Gene summary

Gene information	Gene symbol	SENP2
	Gene ID	59343
	Gene name	SUMO specific peptidase 2
	Synonyms	AXAM2\|SMT3IP2
	Cytomap	3q27.2
	Type of gene	protein-coding
	Description	sentrin-specific protease 2SMT3-specific isopeptidase 2SUMO1/sentrin/SMT3 specific peptidase 2SUMO1/sentrin/SMT3 specific protease 2sentrin (SUMO1) specific peptidase 2sentrin/SUMO-specific protease SENP2
	Modification date	20180523
	UniProtAcc	Q9HC62
	Context	PubMed: SENP2 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID)

Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Gene	GO ID	GO term	PubMed ID
SENP2	GO:0016926	protein desumoylation	20194620
SENP2	GO:0031397	negative regulation of protein ubiquitination	22028379

Top

Exon skipping events across known transcript of Ensembl for SENP2 from UCSC genome browser

Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure.
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Gene isoform structures and expression levels for SENP2

Expression levels of gene isoforms across TCGA.

Expression levels of gene isoforms across GTEx.

Top

Exon skipping events with PSIs in TCGA for SENP2

Information of exkip skipping event in TCGA.

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_380009	3	185304085:185304302:185307901:185307957:185316199:185316333	185307901:185307957	ENSG00000163904.8	ENST00000413407.1,ENST00000453532.1,ENST00000427465.2,ENST00000296257.5
exon_skip_380013	3	185307901:185307957:185316181:185316333:185316745:185316812	185316181:185316333	ENSG00000163904.8	ENST00000458551.1
exon_skip_380015	3	185307901:185307957:185316199:185316333:185316745:185316812	185316199:185316333	ENSG00000163904.8	ENST00000430355.1,ENST00000465201.1,ENST00000545472.1,ENST00000296257.5
exon_skip_380016	3	185307901:185307957:185316199:185316333:185318552:185318613	185316199:185316333	ENSG00000163904.8	ENST00000413407.1,ENST00000427465.2
exon_skip_380018	3	185307901:185307957:185316745:185316812:185318552:185318613	185316745:185316812	ENSG00000163904.8	ENST00000439684.1
exon_skip_380021	3	185316199:185316333:185316745:185316812:185318552:185318613	185316745:185316812	ENSG00000163904.8	ENST00000430355.1,ENST00000458551.1,ENST00000465201.1,ENST00000545472.1,ENST00000296257.5
exon_skip_380023	3	185316199:185316333:185316779:185316812:185318552:185318613	185316779:185316812	ENSG00000163904.8	ENST00000453532.1
exon_skip_380029	3	185318552:185318643:185324117:185324286:185327034:185327073	185324117:185324286	ENSG00000163904.8	ENST00000413407.1,ENST00000430355.1,ENST00000473760.1,ENST00000453532.1,ENST00000545472.1,ENST00000427465.2,ENST00000296257.5
exon_skip_380031	3	185324117:185324286:185327034:185327138:185329438:185329533	185327034:185327138	ENSG00000163904.8	ENST00000413407.1,ENST00000473760.1,ENST00000545472.1,ENST00000427465.2,ENST00000296257.5
exon_skip_380032	3	185327034:185327138:185329438:185329533:185330394:185330446	185329438:185329533	ENSG00000163904.8	ENST00000413407.1,ENST00000459883.1,ENST00000473760.1,ENST00000545472.1,ENST00000427465.2,ENST00000296257.5
exon_skip_380036	3	185331142:185331196:185332351:185332528:185335267:185335297	185332351:185332528	ENSG00000163904.8	ENST00000413407.1,ENST00000545472.1,ENST00000478001.1,ENST00000427465.2,ENST00000296257.5
exon_skip_380037	3	185331142:185331196:185332351:185332528:185337086:185337290	185332351:185332528	ENSG00000163904.8	ENST00000444509.1
exon_skip_380046	3	185332351:185332528:185335267:185335399:185337086:185337224	185335267:185335399	ENSG00000163904.8	ENST00000413407.1,ENST00000545472.1,ENST00000427465.2,ENST00000483005.1,ENST00000296257.5
exon_skip_380050	3	185332351:185332528:185337086:185337290:185339613:185339693	185337086:185337290	ENSG00000163904.8	ENST00000444509.1
exon_skip_380053	3	185335267:185335399:185337086:185337290:185339613:185339693	185337086:185337290	ENSG00000163904.8	ENST00000413407.1,ENST00000545472.1,ENST00000427465.2,ENST00000296257.5
exon_skip_380057	3	185339613:185339693:185341785:185341870:185344085:185344095	185341785:185341870	ENSG00000163904.8	ENST00000413407.1,ENST00000444509.1,ENST00000545472.1,ENST00000427465.2,ENST00000296257.5
exon_skip_380059	3	185341785:185341870:185344085:185344181:185347569:185347740	185344085:185344181	ENSG00000163904.8	ENST00000413407.1,ENST00000545472.1,ENST00000427465.2,ENST00000296257.5

PSI values of skipped exons in TCGA.

Top

Exon skipping events with PSIs in GTEx for SENP2

Information of exkip skipping event in GTEx

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_380009	3	185304085:185304302:185307901:185307957:185316199:185316333	185307901:185307957	ENSG00000163904.8	ENST00000296257.5,ENST00000453532.1,ENST00000413407.1,ENST00000427465.2
exon_skip_380013	3	185307901:185307957:185316181:185316333:185316745:185316812	185316181:185316333	ENSG00000163904.8	ENST00000458551.1
exon_skip_380015	3	185307901:185307957:185316199:185316333:185316745:185316812	185316199:185316333	ENSG00000163904.8	ENST00000430355.1,ENST00000545472.1,ENST00000465201.1,ENST00000296257.5
exon_skip_380016	3	185307901:185307957:185316199:185316333:185318552:185318613	185316199:185316333	ENSG00000163904.8	ENST00000413407.1,ENST00000427465.2
exon_skip_380018	3	185307901:185307957:185316745:185316812:185318552:185318613	185316745:185316812	ENSG00000163904.8	ENST00000439684.1
exon_skip_380021	3	185316199:185316333:185316745:185316812:185318552:185318613	185316745:185316812	ENSG00000163904.8	ENST00000430355.1,ENST00000545472.1,ENST00000465201.1,ENST00000296257.5,ENST00000458551.1
exon_skip_380023	3	185316199:185316333:185316779:185316812:185318552:185318613	185316779:185316812	ENSG00000163904.8	ENST00000453532.1
exon_skip_380029	3	185318552:185318643:185324117:185324286:185327034:185327073	185324117:185324286	ENSG00000163904.8	ENST00000430355.1,ENST00000545472.1,ENST00000296257.5,ENST00000453532.1,ENST00000413407.1,ENST00000427465.2,ENST00000473760.1
exon_skip_380032	3	185327034:185327138:185329438:185329533:185330394:185330446	185329438:185329533	ENSG00000163904.8	ENST00000545472.1,ENST00000296257.5,ENST00000413407.1,ENST00000427465.2,ENST00000473760.1,ENST00000459883.1
exon_skip_380036	3	185331142:185331196:185332351:185332528:185335267:185335297	185332351:185332528	ENSG00000163904.8	ENST00000545472.1,ENST00000296257.5,ENST00000413407.1,ENST00000427465.2,ENST00000478001.1
exon_skip_380037	3	185331142:185331196:185332351:185332528:185337086:185337290	185332351:185332528	ENSG00000163904.8	ENST00000444509.1
exon_skip_380046	3	185332351:185332528:185335267:185335399:185337086:185337224	185335267:185335399	ENSG00000163904.8	ENST00000545472.1,ENST00000296257.5,ENST00000413407.1,ENST00000427465.2,ENST00000483005.1
exon_skip_380050	3	185332351:185332528:185337086:185337290:185339613:185339693	185337086:185337290	ENSG00000163904.8	ENST00000444509.1
exon_skip_380053	3	185335267:185335399:185337086:185337290:185339613:185339693	185337086:185337290	ENSG00000163904.8	ENST00000545472.1,ENST00000296257.5,ENST00000413407.1,ENST00000427465.2
exon_skip_380057	3	185339613:185339693:185341785:185341870:185344085:185344095	185341785:185341870	ENSG00000163904.8	ENST00000545472.1,ENST00000296257.5,ENST00000413407.1,ENST00000427465.2,ENST00000444509.1
exon_skip_380059	3	185341785:185341870:185344085:185344181:185347569:185347740	185344085:185344181	ENSG00000163904.8	ENST00000545472.1,ENST00000296257.5,ENST00000413407.1,ENST00000427465.2

PSI values of skipped exons in GTEx.

* Skipped exon sequences.

Top

Open reading frame (ORF) annotation in the exon skipping event for SENP2

Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms.

ENST	Start of skipped exon	End of skipped exon	ORF
ENST00000296257	185307901	185307957	Frame-shift
ENST00000296257	185316199	185316333	Frame-shift
ENST00000296257	185316745	185316812	Frame-shift
ENST00000296257	185324117	185324286	Frame-shift
ENST00000296257	185327034	185327138	Frame-shift
ENST00000296257	185329438	185329533	Frame-shift
ENST00000296257	185341785	185341870	Frame-shift
ENST00000296257	185332351	185332528	In-frame
ENST00000296257	185335267	185335399	In-frame
ENST00000296257	185337086	185337290	In-frame
ENST00000296257	185344085	185344181	In-frame

Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms.

ENST	Start of skipped exon	End of skipped exon	ORF
ENST00000296257	185307901	185307957	Frame-shift
ENST00000296257	185316199	185316333	Frame-shift
ENST00000296257	185316745	185316812	Frame-shift
ENST00000296257	185324117	185324286	Frame-shift
ENST00000296257	185329438	185329533	Frame-shift
ENST00000296257	185341785	185341870	Frame-shift
ENST00000296257	185332351	185332528	In-frame
ENST00000296257	185335267	185335399	In-frame
ENST00000296257	185337086	185337290	In-frame
ENST00000296257	185344085	185344181	In-frame

Top

Infer the effects of exon skipping event on protein functional features for SENP2

Exon skipping at the protein sequence level and followed lost functional features.
* Click on the image to enlarge it in a new window.

Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases.

ENST	Length of mRNA	Length of AA seq.	Genomic start	Genomic end	mRNA start	mRNA end	AA start	AA end
ENST00000296257	5734	589	185332351	185332528	1174	1350	311	370
ENST00000296257	5734	589	185335267	185335399	1351	1482	370	414
ENST00000296257	5734	589	185337086	185337290	1483	1686	414	482
ENST00000296257	5734	589	185344085	185344181	1852	1947	537	569

Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases.

ENST	Length of mRNA	Length of AA seq.	Genomic start	Genomic end	mRNA start	mRNA end	AA start	AA end
ENST00000296257	5734	589	185332351	185332528	1174	1350	311	370
ENST00000296257	5734	589	185335267	185335399	1351	1482	370	414
ENST00000296257	5734	589	185337086	185337290	1483	1686	414	482
ENST00000296257	5734	589	185344085	185344181	1852	1947	537	569

Lost protein functional features of individual exon skipping events in TCGA.

UniProt acc.	Start of exon skipping (AA)	End of exon skipping (AA)	Protein feature start (AA)	Protein feature end (AA)	Category of protein feature	Description of feature
Q9HC62	311	370	1	589	Chain	ID=PRO_0000101718;Note=Sentrin-specific protease 2
Q9HC62	311	370	370	380	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	311	370	333	333	Modified residue	Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244\|PubMed:23186163;Dbxref=PMID:23186163
Q9HC62	311	370	344	344	Modified residue	Note=Phosphoserine;Ontology_term=ECO:0000244,ECO:0000244;evidence=ECO:0000244\|PubMed:23186163,ECO:0000244\|PubMed:24275569;Dbxref=PMID:23186163,PMID:24275569
Q9HC62	311	370	317	332	Motif	Note=Nuclear export signal
Q9HC62	370	414	381	383	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	370	414	388	392	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	370	414	396	398	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	370	414	1	589	Chain	ID=PRO_0000101718;Note=Sentrin-specific protease 2
Q9HC62	370	414	370	380	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	370	414	399	402	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	370	414	403	405	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	370	414	413	430	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	370	414	396	560	Region	Note=Protease
Q9HC62	370	414	403	403	Sequence conflict	Note=Q->H;Ontology_term=ECO:0000305;evidence=ECO:0000305
Q9HC62	414	482	478	478	Active site	.
Q9HC62	414	482	435	437	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	414	482	466	474	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	414	482	479	485	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	414	482	1	589	Chain	ID=PRO_0000101718;Note=Sentrin-specific protease 2
Q9HC62	414	482	413	430	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	414	482	442	454	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	414	482	455	458	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	414	482	463	465	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	414	482	396	560	Region	Note=Protease
Q9HC62	537	569	548	548	Active site	Note=Nucleophile
Q9HC62	537	569	1	589	Chain	ID=PRO_0000101718;Note=Sentrin-specific protease 2
Q9HC62	537	569	548	560	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	537	569	569	571	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	537	569	548	548	Mutagenesis	Note=Does not desumoylate CEBPB. C->S;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:20194620;Dbxref=PMID:20194620
Q9HC62	537	569	396	560	Region	Note=Protease
Q9HC62	537	569	536	538	Turn	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:1TH0
Q9HC62	537	569	543	546	Turn	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5

Lost protein functional features of individual exon skipping events in GTEx.

UniProt acc.	Start of exon skipping (AA)	End of exon skipping (AA)	Protein feature start (AA)	Protein feature end (AA)	Category of protein feature	Description of feature
Q9HC62	311	370	1	589	Chain	ID=PRO_0000101718;Note=Sentrin-specific protease 2
Q9HC62	311	370	370	380	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	311	370	333	333	Modified residue	Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244\|PubMed:23186163;Dbxref=PMID:23186163
Q9HC62	311	370	344	344	Modified residue	Note=Phosphoserine;Ontology_term=ECO:0000244,ECO:0000244;evidence=ECO:0000244\|PubMed:23186163,ECO:0000244\|PubMed:24275569;Dbxref=PMID:23186163,PMID:24275569
Q9HC62	311	370	317	332	Motif	Note=Nuclear export signal
Q9HC62	370	414	381	383	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	370	414	388	392	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	370	414	396	398	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	370	414	1	589	Chain	ID=PRO_0000101718;Note=Sentrin-specific protease 2
Q9HC62	370	414	370	380	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	370	414	399	402	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	370	414	403	405	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	370	414	413	430	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	370	414	396	560	Region	Note=Protease
Q9HC62	370	414	403	403	Sequence conflict	Note=Q->H;Ontology_term=ECO:0000305;evidence=ECO:0000305
Q9HC62	414	482	478	478	Active site	.
Q9HC62	414	482	435	437	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	414	482	466	474	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	414	482	479	485	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	414	482	1	589	Chain	ID=PRO_0000101718;Note=Sentrin-specific protease 2
Q9HC62	414	482	413	430	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	414	482	442	454	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	414	482	455	458	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	414	482	463	465	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	414	482	396	560	Region	Note=Protease
Q9HC62	537	569	548	548	Active site	Note=Nucleophile
Q9HC62	537	569	1	589	Chain	ID=PRO_0000101718;Note=Sentrin-specific protease 2
Q9HC62	537	569	548	560	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	537	569	569	571	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5
Q9HC62	537	569	548	548	Mutagenesis	Note=Does not desumoylate CEBPB. C->S;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:20194620;Dbxref=PMID:20194620
Q9HC62	537	569	396	560	Region	Note=Protease
Q9HC62	537	569	536	538	Turn	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:1TH0
Q9HC62	537	569	543	546	Turn	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ZO5

Top

SNVs in the skipped exons for SENP2

- Lollipop plot for presenting exon skipping associated SNVs.
* Click on the image to enlarge it in a new window.

- Differential PSIs between mutated versus non-mutated samples.

- Non-synonymous mutations located in the skipped exons in TCGA.

Cancer type	Sample	ESID	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
LIHC	TCGA-DD-A1EG-01	exon_skip_380016 exon_skip_380015 exon_skip_380013	185316182	185316333	185316205	185316205	Frame_Shift_Del	T	-	p.F55fs
LIHC	TCGA-DD-A1EG-01		185316200	185316333	185316205	185316205	Frame_Shift_Del	T	-	p.F55fs
LIHC	TCGA-DD-A1EG-01	exon_skip_380016 exon_skip_380015 exon_skip_380013	185316182	185316333	185316320	185316320	Frame_Shift_Del	C	-	p.A93fs
LIHC	TCGA-DD-A1EG-01		185316200	185316333	185316320	185316320	Frame_Shift_Del	C	-	p.A93fs
LIHC	TCGA-DD-A39Y-01	exon_skip_380016 exon_skip_380015 exon_skip_380013	185316182	185316333	185316320	185316320	Frame_Shift_Del	C	-	p.A93fs
LIHC	TCGA-DD-A39Y-01		185316200	185316333	185316320	185316320	Frame_Shift_Del	C	-	p.A93fs
LIHC	TCGA-DD-A39Y-01	exon_skip_380031	185327035	185327138	185327116	185327116	Frame_Shift_Del	C	-	p.P234fs
CHOL	TCGA-W5-AA39-01	exon_skip_380032	185329439	185329533	185329428	185329449	Frame_Shift_Del	GTGTTTCTAAGTTCTCAAAGAA	-	p.241_244del
COAD	TCGA-CK-5916-01	exon_skip_380032	185329439	185329533	185329480	185329480	Frame_Shift_Del	G	-	p.W255fs
LIHC	TCGA-G3-A3CJ-01	exon_skip_380037 exon_skip_380036	185332352	185332528	185332472	185332472	Frame_Shift_Del	A	-	p.N352fs
LIHC	TCGA-G3-A3CJ-01	exon_skip_380046	185335268	185335399	185335372	185335372	Frame_Shift_Del	A	-	p.L405fs
THCA	TCGA-EM-A4FM-01	exon_skip_380053 exon_skip_380050	185337087	185337290	185337150	185337150	Frame_Shift_Del	C	-	p.H436fs
THCA	TCGA-EM-A4FM-01	exon_skip_380053 exon_skip_380050	185337087	185337290	185337150	185337150	Frame_Shift_Del	C	-	p.L435fs
READ	TCGA-DC-6154-01	exon_skip_380031	185327035	185327138	185327065	185327065	Nonsense_Mutation	C	T	p.R217X
LUAD	TCGA-44-4112-01	exon_skip_380057	185341786	185341870	185341817	185341817	Nonsense_Mutation	A	T	p.R520*
KIRP	TCGA-G7-A8LB-01	exon_skip_380057	185341786	185341870	185341841	185341841	Nonsense_Mutation	G	T	p.E528X
THYM	TCGA-ZT-A8OM-01	exon_skip_380032	185329439	185329533	185329535	185329535	Splice_Site	T	C	.

- Depth of coverage in the three exons composing exon skipping event

Depth of coverage in three exons

Mutation description

- Non-synonymous mutations located in the skipped exons in CCLE.

Sample	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
AN3CA_ENDOMETRIUM	185316200	185316333	185316220	185316220	Frame_Shift_Del	A	-	p.K60fs
AN3CA_ENDOMETRIUM	185316182	185316333	185316220	185316220	Frame_Shift_Del	A	-	p.K60fs
MFE319_ENDOMETRIUM	185329439	185329533	185329480	185329480	Frame_Shift_Del	G	-	p.W255fs
CW2_LARGE_INTESTINE	185329439	185329533	185329480	185329480	Frame_Shift_Del	G	-	p.W255fs
MDAPCA2B_PROSTATE	185337087	185337290	185337221	185337222	Frame_Shift_Ins	-	G	p.G460fs
HEC251_ENDOMETRIUM	185316746	185316812	185316753	185316753	Missense_Mutation	C	T	p.S100L
MDAMB415_BREAST	185324118	185324286	185324239	185324239	Missense_Mutation	G	A	p.E191K
NCIH2342_LUNG	185324118	185324286	185324254	185324254	Missense_Mutation	G	T	p.G196C
NCIH322_LUNG	185327035	185327138	185327056	185327056	Missense_Mutation	G	C	p.E214Q
BICR10_UPPER_AERODIGESTIVE_TRACT	185327035	185327138	185327066	185327066	Missense_Mutation	G	T	p.R217L
SNU1040_LARGE_INTESTINE	185327035	185327138	185327066	185327066	Missense_Mutation	G	A	p.R217Q
U118MG_CENTRAL_NERVOUS_SYSTEM	185329439	185329533	185329509	185329509	Missense_Mutation	A	G	p.T265A
RS411_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	185332352	185332528	185332362	185332362	Missense_Mutation	A	G	p.Y315C
EBC1_LUNG	185335268	185335399	185335275	185335275	Missense_Mutation	A	G	p.E373G
SF539_CENTRAL_NERVOUS_SYSTEM	185335268	185335399	185335366	185335366	Missense_Mutation	G	C	p.Q403H
EN_ENDOMETRIUM	185337087	185337290	185337165	185337165	Missense_Mutation	T	C	p.F441L
CHSA0108_BONE	185337087	185337290	185337210	185337210	Missense_Mutation	C	G	p.R456G
HCC2998_LARGE_INTESTINE	185341786	185341870	185341818	185341818	Missense_Mutation	G	T	p.R520I
TE441T_SOFT_TISSUE	185341786	185341870	185341868	185341868	Missense_Mutation	C	T	p.H537Y
MIAPACA2_PANCREAS	185335268	185335399	185335310	185335310	Nonsense_Mutation	C	T	p.Q385*
JHUEM7_ENDOMETRIUM	185337087	185337290	185337243	185337243	Nonsense_Mutation	G	T	p.E467*

Top

Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for SENP2

sQTL information located at the skipped exons.

Exon skip ID

Chromosome

Three exons

Skippped exon

ENST

Cancer type

SNP id

Location

DNA change (ref/var)

P-value

Top

Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for SENP2

Top

Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for SENP2

Top

RelatedDrugs for SENP2

Approved drugs targeting this gene.
(DrugBank Version 5.1.0 2018-04-02)

Gene

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

RelatedDiseases for SENP2

Diseases associated with this gene.
(DisGeNet 4.0)

Gene

Disease ID

Disease name

# pubmeds

Source

	Gene summary
	Gene structures and expression levels
	Exon skipping events with PSIs in TCGA
	Exon skipping events with PSIs in GTEx
	Open reading frame (ORF) annotation in the exon skipping event
	Exon skipping events in the canonical protein sequence
	SNVs in the skipped exons with depth of coverage
	Splicing Quantitative Trait Loci (sQTLs) in the skipped exons
	Splicing Quantitative Trait Methylation (sQTM) in the skipped exon
	Related drugs with this gene
	Related diseases with this gene

Home

Download

Statistics

Landscape

Help

Contact