|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for SIGIRR |
 Gene summary |
| Gene information | Gene symbol | SIGIRR | Gene ID | 59307 |
| Gene name | single Ig and TIR domain containing | |
| Synonyms | IL-1R8|TIR8 | |
| Cytomap | 11p15.5 | |
| Type of gene | protein-coding | |
| Description | single Ig IL-1-related receptorinterleukin-1 receptor 8 long isoformsingle Ig IL-1R-related moleculesingle immunoglobulin and toll-interleukin 1 receptor (TIR) domainsingle immunoglobulin domain IL1R1 relatedsingle immunoglobulin domain-containing IL | |
| Modification date | 20180519 | |
| UniProtAcc | Q6IA17 | |
| Context | PubMed: SIGIRR [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for SIGIRR from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for SIGIRR |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for SIGIRR |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_67069 | 11 | 405727:406059:406348:406538:406842:406993 | 406348:406538 | ENSG00000185187.8 | ENST00000332725.3,ENST00000527987.1,ENST00000397632.3,ENST00000431843.2 |
| exon_skip_67070 | 11 | 405727:406059:406348:406538:407061:407135 | 406348:406538 | ENSG00000185187.8 | ENST00000526395.1 |
| exon_skip_67074 | 11 | 406348:406538:406842:406993:407061:407135 | 406842:406993 | ENSG00000185187.8 | ENST00000382520.2,ENST00000531205.1,ENST00000332725.3,ENST00000527987.1,ENST00000397632.3,ENST00000431843.2 |
| exon_skip_67079 | 11 | 407896:407957:408072:408206:408694:408851 | 408072:408206 | ENSG00000185187.8 | ENST00000527136.1,ENST00000530683.1,ENST00000382520.2,ENST00000531205.1,ENST00000332725.3,ENST00000397632.3,ENST00000431843.2,ENST00000528116.1 |
| exon_skip_67080 | 11 | 407896:407957:408072:408206:409867:409977 | 408072:408206 | ENSG00000185187.8 | ENST00000527295.1,ENST00000534217.1,ENST00000528209.1 |
| exon_skip_67083 | 11 | 407896:407957:408694:408893:409867:409977 | 408694:408893 | ENSG00000185187.8 | ENST00000528698.1,ENST00000530494.1 |
| exon_skip_67092 | 11 | 408072:408206:408694:408893:409859:410027 | 408694:408893 | ENSG00000185187.8 | ENST00000528116.1 |
| exon_skip_67093 | 11 | 408072:408206:408694:408893:409867:409977 | 408694:408893 | ENSG00000185187.8 | ENST00000530683.1,ENST00000382520.2,ENST00000531205.1,ENST00000332725.3,ENST00000397632.3,ENST00000431843.2 |
| exon_skip_67094 | 11 | 408072:408206:408694:408893:414822:414923 | 408694:408893 | ENSG00000185187.8 | ENST00000527136.1 |
| exon_skip_67097 | 11 | 408072:408206:408893:409101:409867:409977 | 408893:409101 | ENSG00000185187.8 | ENST00000529486.1 |
| exon_skip_67107 | 11 | 408072:408206:409867:410027:414822:414923 | 409867:410027 | ENSG00000185187.8 | ENST00000534217.1,ENST00000528209.1 |
| exon_skip_67108 | 11 | 408072:408206:409867:410027:417293:417325 | 409867:410027 | ENSG00000185187.8 | ENST00000527295.1 |
| exon_skip_67118 | 11 | 408762:408893:409216:409308:409867:409977 | 409216:409308 | ENSG00000185187.8 | ENST00000528058.1 |
| exon_skip_67119 | 11 | 408762:408893:409859:410027:414822:414923 | 409859:410027 | ENSG00000185187.8 | ENST00000528116.1 |
| exon_skip_67128 | 11 | 408762:408893:409867:410027:414822:414923 | 409867:410027 | ENSG00000185187.8 | ENST00000530494.1,ENST00000431843.2 |
| exon_skip_67129 | 11 | 408762:408893:409867:410027:417293:417325 | 409867:410027 | ENSG00000185187.8 | ENST00000382520.2,ENST00000397632.3 |
| exon_skip_67130 | 11 | 408762:408893:409867:410027:417324:417397 | 409867:410027 | ENSG00000185187.8 | ENST00000332725.3 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for SIGIRR |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_67069 | 11 | 405727:406059:406348:406538:406842:406993 | 406348:406538 | ENSG00000185187.8 | ENST00000431843.2,ENST00000397632.3,ENST00000332725.3,ENST00000527987.1 |
| exon_skip_67070 | 11 | 405727:406059:406348:406538:407061:407135 | 406348:406538 | ENSG00000185187.8 | ENST00000526395.1 |
| exon_skip_67074 | 11 | 406348:406538:406842:406993:407061:407135 | 406842:406993 | ENSG00000185187.8 | ENST00000431843.2,ENST00000397632.3,ENST00000332725.3,ENST00000527987.1,ENST00000531205.1,ENST00000382520.2 |
| exon_skip_67079 | 11 | 407896:407957:408072:408206:408694:408851 | 408072:408206 | ENSG00000185187.8 | ENST00000431843.2,ENST00000397632.3,ENST00000332725.3,ENST00000531205.1,ENST00000382520.2,ENST00000530683.1,ENST00000528116.1,ENST00000527136.1 |
| exon_skip_67080 | 11 | 407896:407957:408072:408206:409867:409977 | 408072:408206 | ENSG00000185187.8 | ENST00000527295.1,ENST00000528209.1,ENST00000534217.1 |
| exon_skip_67083 | 11 | 407896:407957:408694:408893:409867:409977 | 408694:408893 | ENSG00000185187.8 | ENST00000528698.1,ENST00000530494.1 |
| exon_skip_67092 | 11 | 408072:408206:408694:408893:409859:410027 | 408694:408893 | ENSG00000185187.8 | ENST00000528116.1 |
| exon_skip_67093 | 11 | 408072:408206:408694:408893:409867:409977 | 408694:408893 | ENSG00000185187.8 | ENST00000431843.2,ENST00000397632.3,ENST00000332725.3,ENST00000531205.1,ENST00000382520.2,ENST00000530683.1 |
| exon_skip_67094 | 11 | 408072:408206:408694:408893:414822:414923 | 408694:408893 | ENSG00000185187.8 | ENST00000527136.1 |
| exon_skip_67097 | 11 | 408072:408206:408893:409101:409867:409977 | 408893:409101 | ENSG00000185187.8 | ENST00000529486.1 |
| exon_skip_67107 | 11 | 408072:408206:409867:410027:414822:414923 | 409867:410027 | ENSG00000185187.8 | ENST00000528209.1,ENST00000534217.1 |
| exon_skip_67108 | 11 | 408072:408206:409867:410027:417293:417325 | 409867:410027 | ENSG00000185187.8 | ENST00000527295.1 |
| exon_skip_67118 | 11 | 408762:408893:409216:409308:409867:409977 | 409216:409308 | ENSG00000185187.8 | ENST00000528058.1 |
| exon_skip_67119 | 11 | 408762:408893:409859:410027:414822:414923 | 409859:410027 | ENSG00000185187.8 | ENST00000528116.1 |
| exon_skip_67128 | 11 | 408762:408893:409867:410027:414822:414923 | 409867:410027 | ENSG00000185187.8 | ENST00000431843.2,ENST00000530494.1 |
| exon_skip_67129 | 11 | 408762:408893:409867:410027:417293:417325 | 409867:410027 | ENSG00000185187.8 | ENST00000397632.3,ENST00000382520.2 |
| exon_skip_67130 | 11 | 408762:408893:409867:410027:417324:417397 | 409867:410027 | ENSG00000185187.8 | ENST00000332725.3 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for SIGIRR |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000332725 | 409867 | 410027 | 3UTR-3CDS |
| ENST00000397632 | 409867 | 410027 | 3UTR-3CDS |
| ENST00000431843 | 409867 | 410027 | 3UTR-3CDS |
| ENST00000332725 | 406348 | 406538 | Frame-shift |
| ENST00000397632 | 406348 | 406538 | Frame-shift |
| ENST00000431843 | 406348 | 406538 | Frame-shift |
| ENST00000332725 | 406842 | 406993 | Frame-shift |
| ENST00000397632 | 406842 | 406993 | Frame-shift |
| ENST00000431843 | 406842 | 406993 | Frame-shift |
| ENST00000332725 | 408072 | 408206 | Frame-shift |
| ENST00000397632 | 408072 | 408206 | Frame-shift |
| ENST00000431843 | 408072 | 408206 | Frame-shift |
| ENST00000332725 | 408694 | 408893 | Frame-shift |
| ENST00000397632 | 408694 | 408893 | Frame-shift |
| ENST00000431843 | 408694 | 408893 | Frame-shift |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000332725 | 409867 | 410027 | 3UTR-3CDS |
| ENST00000397632 | 409867 | 410027 | 3UTR-3CDS |
| ENST00000431843 | 409867 | 410027 | 3UTR-3CDS |
| ENST00000332725 | 406348 | 406538 | Frame-shift |
| ENST00000397632 | 406348 | 406538 | Frame-shift |
| ENST00000431843 | 406348 | 406538 | Frame-shift |
| ENST00000332725 | 406842 | 406993 | Frame-shift |
| ENST00000397632 | 406842 | 406993 | Frame-shift |
| ENST00000431843 | 406842 | 406993 | Frame-shift |
| ENST00000332725 | 408072 | 408206 | Frame-shift |
| ENST00000397632 | 408072 | 408206 | Frame-shift |
| ENST00000431843 | 408072 | 408206 | Frame-shift |
| ENST00000332725 | 408694 | 408893 | Frame-shift |
| ENST00000397632 | 408694 | 408893 | Frame-shift |
| ENST00000431843 | 408694 | 408893 | Frame-shift |
Top |
Infer the effects of exon skipping event on protein functional features for SIGIRR |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
Top |
SNVs in the skipped exons for SIGIRR |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_67070 exon_skip_67069 | 406349 | 406538 | 406457 | 406457 | Frame_Shift_Del | G | - | p.Q321fs |
| COAD | TCGA-F4-6856-01 | exon_skip_67070 exon_skip_67069 | 406349 | 406538 | 406484 | 406484 | Nonsense_Mutation | G | A | p.Q312X |
| BLCA | TCGA-DK-A3IQ-01 | exon_skip_67079 exon_skip_67080 | 408073 | 408206 | 408082 | 408082 | Nonsense_Mutation | G | A | p.Q111* |
| STAD | TCGA-BR-8487-01 | exon_skip_67070 exon_skip_67069 | 406349 | 406538 | 406540 | 406541 | Splice_Site | - | G | . |
| STAD | TCGA-BR-8487-01 | exon_skip_67070 exon_skip_67069 | 406349 | 406538 | 406540 | 406541 | Splice_Site | - | G | p.T294_splice |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| NCIH1435_LUNG | 408695 | 408893 | 408814 | 408841 | Frame_Shift_Del | AGCCACTGAGCTGCCCAAGGCAGGCCTC | - | p.LRPALGSSVA20fs |
| PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 408073 | 408206 | 408129 | 408130 | Frame_Shift_Ins | - | C | p.A95fs |
| PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 406349 | 406538 | 406366 | 406366 | Missense_Mutation | T | C | p.D351G |
| MEWO_SKIN | 406349 | 406538 | 406409 | 406409 | Missense_Mutation | G | C | p.R337G |
| MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 406349 | 406538 | 406493 | 406493 | Missense_Mutation | G | A | p.R309W |
| HCT15_LARGE_INTESTINE | 406349 | 406538 | 406501 | 406501 | Missense_Mutation | G | A | p.A306V |
| ME1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 406843 | 406993 | 406932 | 406932 | Missense_Mutation | G | C | p.Q264E |
| NCIH747_LARGE_INTESTINE | 408073 | 408206 | 408093 | 408093 | Missense_Mutation | G | A | p.S107F |
| MZ1B_MATCHED_NORMAL_TISSUE | 408073 | 408206 | 408093 | 408093 | Missense_Mutation | G | A | p.S107F |
| MZ1PC_PANCREAS | 408073 | 408206 | 408093 | 408093 | Missense_Mutation | G | A | p.S107F |
| SNU1040_LARGE_INTESTINE | 408695 | 408893 | 408705 | 408706 | Missense_Mutation | CG | TA | p.E66K |
| NCIH1435_LUNG | 408695 | 408893 | 408818 | 408818 | Missense_Mutation | A | C | p.V28G |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for SIGIRR |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for SIGIRR |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for SIGIRR |
Top |
RelatedDrugs for SIGIRR |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for SIGIRR |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|