ExonSkipDB: functional annotation of exon skipping event in human

Gene summary for RB1

Gene summary

Gene information	Gene symbol	RB1
	Gene ID	5925
	Gene name	RB transcriptional corepressor 1
	Synonyms	OSRC\|PPP1R130\|RB\|p105-Rb\|pRb\|pp110
	Cytomap	13q14.2
	Type of gene	protein-coding
	Description	retinoblastoma-associated proteinGOS563 exon 17 substitution mutation causes premature stopexon 17 tumor GOS561 substitution mutation causes premature stopprepro-retinoblastoma-associated proteinprotein phosphatase 1, regulatory subunit 130retinoblas
	Modification date	20180523
	UniProtAcc	P06400
	Context	PubMed: RB1 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID)

Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Gene	GO ID	GO term	PubMed ID
RB1	GO:0043550	regulation of lipid kinase activity	16286473
RB1	GO:0045892	negative regulation of transcription, DNA-templated	10783144\|12065415\|19223331
RB1	GO:2000679	positive regulation of transcription regulatory region DNA binding	25100735

Top

Exon skipping events across known transcript of Ensembl for RB1 from UCSC genome browser

Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure.
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Gene isoform structures and expression levels for RB1

Expression levels of gene isoforms across TCGA.

Expression levels of gene isoforms across GTEx.

Top

Exon skipping events with PSIs in TCGA for RB1

Information of exkip skipping event in TCGA.

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_100313	13	48877910:48878185:48881415:48881542:48916734:48916850	48881415:48881542	ENSG00000139687.9	ENST00000267163.4
exon_skip_100314	13	48934152:48934263:48936950:48937093:48939029:48939107	48936950:48937093	ENSG00000139687.9	ENST00000267163.4
exon_skip_100315	13	48947540:48947628:48951053:48951170:48953729:48953786	48951053:48951170	ENSG00000139687.9	ENST00000267163.4
exon_skip_100319	13	48951053:48951170:48953729:48953786:48954188:48954220	48953729:48953786	ENSG00000139687.9	ENST00000267163.4
exon_skip_100320	13	49033823:49033969:49037866:49037971:49039133:49039247	49037866:49037971	ENSG00000139687.9	ENST00000267163.4
exon_skip_100321	13	49037866:49037971:49039133:49039247:49039340:49039504	49039133:49039247	ENSG00000139687.9	ENST00000267163.4
exon_skip_100324	13	49039340:49039504:49047495:49047526:49050836:49050979	49047495:49047526	ENSG00000139687.9	ENST00000267163.4

PSI values of skipped exons in TCGA.

Top

Exon skipping events with PSIs in GTEx for RB1

Information of exkip skipping event in GTEx

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_100313	13	48877910:48878185:48881415:48881542:48916734:48916850	48881415:48881542	ENSG00000139687.9	ENST00000267163.4
exon_skip_100314	13	48934152:48934263:48936950:48937093:48939029:48939107	48936950:48937093	ENSG00000139687.9	ENST00000267163.4
exon_skip_100315	13	48947540:48947628:48951053:48951170:48953729:48953786	48951053:48951170	ENSG00000139687.9	ENST00000267163.4
exon_skip_100319	13	48951053:48951170:48953729:48953786:48954188:48954220	48953729:48953786	ENSG00000139687.9	ENST00000267163.4
exon_skip_100320	13	49033823:49033969:49037866:49037971:49039133:49039247	49037866:49037971	ENSG00000139687.9	ENST00000267163.4
exon_skip_100321	13	49037866:49037971:49039133:49039247:49039340:49039504	49039133:49039247	ENSG00000139687.9	ENST00000267163.4
exon_skip_100324	13	49039340:49039504:49047495:49047526:49050836:49050979	49047495:49047526	ENSG00000139687.9	ENST00000267163.4

PSI values of skipped exons in GTEx.

* Skipped exon sequences.

Top

Open reading frame (ORF) annotation in the exon skipping event for RB1

Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms.

ENST	Start of skipped exon	End of skipped exon	ORF
ENST00000267163	48881415	48881542	Frame-shift
ENST00000267163	48936950	48937093	Frame-shift
ENST00000267163	49047495	49047526	Frame-shift
ENST00000267163	48951053	48951170	In-frame
ENST00000267163	48953729	48953786	In-frame
ENST00000267163	49037866	49037971	In-frame
ENST00000267163	49039133	49039247	In-frame

Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms.

ENST	Start of skipped exon	End of skipped exon	ORF
ENST00000267163	48881415	48881542	Frame-shift
ENST00000267163	48936950	48937093	Frame-shift
ENST00000267163	49047495	49047526	Frame-shift
ENST00000267163	48951053	48951170	In-frame
ENST00000267163	48953729	48953786	In-frame
ENST00000267163	49037866	49037971	In-frame
ENST00000267163	49039133	49039247	In-frame

Top

Infer the effects of exon skipping event on protein functional features for RB1

Exon skipping at the protein sequence level and followed lost functional features.
* Click on the image to enlarge it in a new window.

Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases.

ENST	Length of mRNA	Length of AA seq.	Genomic start	Genomic end	mRNA start	mRNA end	AA start	AA end
ENST00000267163	4857	928	48951053	48951170	1354	1470	405	444
ENST00000267163	4857	928	48953729	48953786	1471	1527	444	463
ENST00000267163	4857	928	49037866	49037971	2245	2349	702	737
ENST00000267163	4857	928	49039133	49039247	2350	2463	737	775

Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases.

ENST	Length of mRNA	Length of AA seq.	Genomic start	Genomic end	mRNA start	mRNA end	AA start	AA end
ENST00000267163	4857	928	48951053	48951170	1354	1470	405	444
ENST00000267163	4857	928	48953729	48953786	1471	1527	444	463
ENST00000267163	4857	928	49037866	49037971	2245	2349	702	737
ENST00000267163	4857	928	49039133	49039247	2350	2463	737	775

Lost protein functional features of individual exon skipping events in TCGA.

UniProt acc.	Start of exon skipping (AA)	End of exon skipping (AA)	Protein feature start (AA)	Protein feature end (AA)	Category of protein feature	Description of feature
P06400	405	444	407	409	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	405	444	2	928	Chain	ID=PRO_0000167836;Note=Retinoblastoma-associated protein
P06400	405	444	398	405	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	405	444	412	434	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	405	444	436	438	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	405	444	439	468	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	405	444	436	436	Natural variant	ID=VAR_019379;Note=Q->K;Ontology_term=ECO:0000269;evidence=ECO:0000269\|Ref.7;Dbxref=dbSNP:rs4151534
P06400	405	444	373	771	Region	Note=Pocket%3B binds T and E1A
P06400	405	444	373	579	Region	Note=Domain A
P06400	444	463	2	928	Chain	ID=PRO_0000167836;Note=Retinoblastoma-associated protein
P06400	444	463	439	468	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	444	463	447	447	Natural variant	ID=VAR_010048;Note=In RB. K->Q;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:9140452;Dbxref=PMID:9140452
P06400	444	463	457	457	Natural variant	ID=VAR_005576;Note=In RB. M->R;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:8346255;Dbxref=PMID:8346255
P06400	444	463	373	771	Region	Note=Pocket%3B binds T and E1A
P06400	444	463	373	579	Region	Note=Domain A
P06400	702	737	731	733	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:1N4M
P06400	702	737	2	928	Chain	ID=PRO_0000167836;Note=Retinoblastoma-associated protein
P06400	702	737	700	714	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	702	737	721	728	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	702	737	737	740	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	702	737	706	706	Natural variant	ID=VAR_005586;Note=In RB. C->Y
P06400	702	737	712	712	Natural variant	ID=VAR_005587;Note=In RB. C->R;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:10671068;Dbxref=dbSNP:rs137853296,PMID:10671068
P06400	702	737	373	771	Region	Note=Pocket%3B binds T and E1A
P06400	702	737	640	771	Region	Note=Domain B
P06400	737	775	741	743	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	737	775	745	747	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	737	775	748	750	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:4ELJ
P06400	737	775	773	775	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	737	775	2	928	Chain	ID=PRO_0000167836;Note=Retinoblastoma-associated protein
P06400	737	775	737	740	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	737	775	752	758	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	737	775	760	770	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	737	775	746	746	Natural variant	ID=VAR_034442;Note=E->G;Dbxref=dbSNP:rs3092905
P06400	737	775	373	771	Region	Note=Pocket%3B binds T and E1A
P06400	737	775	640	771	Region	Note=Domain B
P06400	737	775	763	928	Region	Note=Interaction with LIMD1;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:15542589;Dbxref=PMID:15542589
P06400	737	775	771	928	Region	Note=Domain C%3B mediates interaction with E4F1;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:10869426;Dbxref=PMID:10869426

Lost protein functional features of individual exon skipping events in GTEx.

UniProt acc.	Start of exon skipping (AA)	End of exon skipping (AA)	Protein feature start (AA)	Protein feature end (AA)	Category of protein feature	Description of feature
P06400	405	444	407	409	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	405	444	2	928	Chain	ID=PRO_0000167836;Note=Retinoblastoma-associated protein
P06400	405	444	398	405	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	405	444	412	434	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	405	444	436	438	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	405	444	439	468	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	405	444	436	436	Natural variant	ID=VAR_019379;Note=Q->K;Ontology_term=ECO:0000269;evidence=ECO:0000269\|Ref.7;Dbxref=dbSNP:rs4151534
P06400	405	444	373	771	Region	Note=Pocket%3B binds T and E1A
P06400	405	444	373	579	Region	Note=Domain A
P06400	444	463	2	928	Chain	ID=PRO_0000167836;Note=Retinoblastoma-associated protein
P06400	444	463	439	468	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	444	463	447	447	Natural variant	ID=VAR_010048;Note=In RB. K->Q;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:9140452;Dbxref=PMID:9140452
P06400	444	463	457	457	Natural variant	ID=VAR_005576;Note=In RB. M->R;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:8346255;Dbxref=PMID:8346255
P06400	444	463	373	771	Region	Note=Pocket%3B binds T and E1A
P06400	444	463	373	579	Region	Note=Domain A
P06400	702	737	731	733	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:1N4M
P06400	702	737	2	928	Chain	ID=PRO_0000167836;Note=Retinoblastoma-associated protein
P06400	702	737	700	714	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	702	737	721	728	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	702	737	737	740	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	702	737	706	706	Natural variant	ID=VAR_005586;Note=In RB. C->Y
P06400	702	737	712	712	Natural variant	ID=VAR_005587;Note=In RB. C->R;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:10671068;Dbxref=dbSNP:rs137853296,PMID:10671068
P06400	702	737	373	771	Region	Note=Pocket%3B binds T and E1A
P06400	702	737	640	771	Region	Note=Domain B
P06400	737	775	741	743	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	737	775	745	747	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	737	775	748	750	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:4ELJ
P06400	737	775	773	775	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	737	775	2	928	Chain	ID=PRO_0000167836;Note=Retinoblastoma-associated protein
P06400	737	775	737	740	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	737	775	752	758	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	737	775	760	770	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2R7G
P06400	737	775	746	746	Natural variant	ID=VAR_034442;Note=E->G;Dbxref=dbSNP:rs3092905
P06400	737	775	373	771	Region	Note=Pocket%3B binds T and E1A
P06400	737	775	640	771	Region	Note=Domain B
P06400	737	775	763	928	Region	Note=Interaction with LIMD1;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:15542589;Dbxref=PMID:15542589
P06400	737	775	771	928	Region	Note=Domain C%3B mediates interaction with E4F1;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:10869426;Dbxref=PMID:10869426

Top

SNVs in the skipped exons for RB1

- Lollipop plot for presenting exon skipping associated SNVs.
* Click on the image to enlarge it in a new window.

- Differential PSIs between mutated versus non-mutated samples.

RB1_CESC_exon_skip_100321_psi_boxplot.png
boxplot

RB1_LGG_exon_skip_100319_psi_boxplot.png
boxplot

RB1_LIHC_exon_skip_100319_psi_boxplot.png
boxplot

RB1_LUSC_exon_skip_100319_psi_boxplot.png
boxplot

RB1_SARC_exon_skip_100319_psi_boxplot.png
boxplot

RB1_SARC_exon_skip_100320_psi_boxplot.png
boxplot

RB1_SKCM_exon_skip_100319_psi_boxplot.png
boxplot

RB1_SKCM_exon_skip_100321_psi_boxplot.png
boxplot

- Non-synonymous mutations located in the skipped exons in TCGA.

Cancer type	Sample	ESID	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
HNSC	TCGA-CQ-5327-01	exon_skip_100313	48881416	48881542	48881435	48881435	Frame_Shift_Del	G	-	p.E54fs
BLCA	TCGA-4Z-AA81-01	exon_skip_100313	48881416	48881542	48881511	48881511	Frame_Shift_Del	G	-	p.W78fs
LIHC	TCGA-DD-AADM-01	exon_skip_100314	48936951	48937093	48936988	48936988	Frame_Shift_Del	A	-	p.T252fs
BRCA	TCGA-BH-A0C7-01	exon_skip_100314	48936951	48937093	48936989	48936989	Frame_Shift_Del	C	-	p.R254fs
STAD	TCGA-BR-A452-01	exon_skip_100314	48936951	48937093	48937043	48937046	Frame_Shift_Del	ACAA	-	p.270_271del
STAD	TCGA-BR-A452-01	exon_skip_100314	48936951	48937093	48937043	48937046	Frame_Shift_Del	ACAA	-	p.T271fs
MESO	TCGA-ZN-A9VW-01	exon_skip_100314	48936951	48937093	48937087	48937087	Frame_Shift_Del	A	-	p.I285fs
UCEC	TCGA-B5-A0K9-01	exon_skip_100315	48951054	48951170	48951087	48951088	Frame_Shift_Del	AA	-	p.K417fs
SARC	TCGA-IS-A3KA-01	exon_skip_100315	48951054	48951170	48951157	48951157	Frame_Shift_Del	A	-	p.E440fs
SARC	TCGA-IS-A3KA-01	exon_skip_100315	48951054	48951170	48951157	48951157	Frame_Shift_Del	A	-	p.I441fs
LUAD	TCGA-78-7143-01	exon_skip_100315	48951054	48951170	48951168	48951168	Frame_Shift_Del	C	-	p.Q444fs
LIHC	TCGA-UB-A7MB-01	exon_skip_100319	48953730	48953786	48953748	48953748	Frame_Shift_Del	C	-	p.R451fs
LIHC	TCGA-UB-A7MB-01	exon_skip_100319	48953730	48953786	48953748	48953748	Frame_Shift_Del	C	-	p.V450fs
BLCA	TCGA-GC-A3YS-01	exon_skip_100320	49037867	49037971	49037882	49037897	Frame_Shift_Del	ATGTATGGCATATGCA	-	p.M708fs
BLCA	TCGA-GC-A3YS-01	exon_skip_100320	49037867	49037971	49037882	49037897	Frame_Shift_Del	ATGTATGGCATATGCA	-	p.MYGICK708fs
LIHC	TCGA-5C-AAPD-01	exon_skip_100320	49037867	49037971	49037924	49037924	Frame_Shift_Del	A	-	p.F721fs
LIHC	TCGA-DD-A3A0-01	exon_skip_100320	49037867	49037971	49037924	49037924	Frame_Shift_Del	A	-	p.K722fs
SARC	TCGA-DX-A7EM-01	exon_skip_100320	49037867	49037971	49037932	49037933	Frame_Shift_Del	TG	-	p.IV724fs
SARC	TCGA-DX-A7EM-01	exon_skip_100320	49037867	49037971	49037932	49037933	Frame_Shift_Del	TG	-	p.V725fs
BLCA	TCGA-FD-A6TH-01	exon_skip_100320	49037867	49037971	49037940	49037950	Frame_Shift_Del	CATACAAGGAT	-	p.AYKD727fs
SKCM	TCGA-EB-A5FP-01	exon_skip_100321	49039134	49039247	49039149	49039179	Frame_Shift_Del	TTGATCAAAGAAGAGGAGTATGATTCTATTA	-	p.LIKEEEYDSII743fs
BLCA	TCGA-FD-A3SL-01	exon_skip_100321	49039134	49039247	49039151	49039160	Frame_Shift_Del	GATCAAAGAA	-	p.L743fs
BLCA	TCGA-FD-A3SL-01	exon_skip_100321	49039134	49039247	49039151	49039160	Frame_Shift_Del	GATCAAAGAA	-	p.LIKE743fs
HNSC	TCGA-CV-6939-01	exon_skip_100321	49039134	49039247	49039220	49039220	Frame_Shift_Del	A	-	p.T766fs
BLCA	TCGA-XF-A9ST-01	exon_skip_100313	48881416	48881542	48881488	48881489	Frame_Shift_Ins	-	AG	p.R71fs
BRCA	TCGA-BH-A0BW-01	exon_skip_100313	48881416	48881542	48881488	48881489	Frame_Shift_Ins	-	AG	p.A73fs
LUSC	TCGA-22-4607-01	exon_skip_100313	48881416	48881542	48881488	48881489	Frame_Shift_Ins	-	AG	p.V70fs
BLCA	TCGA-LC-A66R-01	exon_skip_100314	48936951	48937093	48937039	48937040	Frame_Shift_Ins	-	A	p.D270fs
BLCA	TCGA-BT-A3PJ-01	exon_skip_100314	48936951	48937093	48937042	48937043	Frame_Shift_Ins	-	A	p.D270fs
BLCA	TCGA-BT-A3PJ-01	exon_skip_100314	48936951	48937093	48937042	48937043	Frame_Shift_Ins	-	A	p.T271fs
BLCA	TCGA-K4-A5RH-01	exon_skip_100315	48951054	48951170	48951092	48951093	Frame_Shift_Ins	-	G	p.V419fs
LIHC	TCGA-G3-A5SI-01	exon_skip_100319	48953730	48953786	48953741	48953742	Frame_Shift_Ins	-	G	p.L448fs
LIHC	TCGA-G3-A5SI-01	exon_skip_100319	48953730	48953786	48953741	48953742	Frame_Shift_Ins	-	G	p.S449fs
SKCM	TCGA-D3-A8GM-06	exon_skip_100321	49039134	49039247	49039224	49039225	Frame_Shift_Ins	-	T	p.F768fs
BLCA	TCGA-XF-AAN2-01	exon_skip_100313	48881416	48881542	48881435	48881435	Nonsense_Mutation	G	T	p.E53*
BLCA	TCGA-BT-A20R-01	exon_skip_100313	48881416	48881542	48881462	48881462	Nonsense_Mutation	C	T	p.Q62*
THYM	TCGA-3G-AB19-01	exon_skip_100313	48881416	48881542	48881492	48881492	Nonsense_Mutation	G	T	p.E72X
HNSC	TCGA-CR-7398-01	exon_skip_100313	48881416	48881542	48881512	48881512	Nonsense_Mutation	G	A	p.W78*
LIHC	TCGA-DD-A113-01	exon_skip_100313	48881416	48881542	48881512	48881512	Nonsense_Mutation	G	A	p.W78*
LIHC	TCGA-DD-A113-01	exon_skip_100313	48881416	48881542	48881512	48881512	Nonsense_Mutation	G	A	p.W78X
SKCM	TCGA-FW-A3TU-06	exon_skip_100314	48936951	48937093	48936978	48936978	Nonsense_Mutation	C	G	p.S249*
SKCM	TCGA-FW-A3TU-06	exon_skip_100314	48936951	48937093	48936978	48936978	Nonsense_Mutation	C	G	p.S249X
BLCA	TCGA-FD-A3SO-01	exon_skip_100314	48936951	48937093	48936983	48936983	Nonsense_Mutation	C	T	p.R251*
HNSC	TCGA-KU-A6H7-01	exon_skip_100314	48936951	48937093	48936983	48936983	Nonsense_Mutation	C	T	p.R251*
BLCA	TCGA-DK-AA6T-01	exon_skip_100314	48936951	48937093	48936995	48936995	Nonsense_Mutation	C	T	p.R255*
SKCM	TCGA-EE-A29B-06	exon_skip_100314	48936951	48937093	48937001	48937001	Nonsense_Mutation	C	T	p.Q257*
SKCM	TCGA-EE-A29B-06	exon_skip_100314	48936951	48937093	48937001	48937001	Nonsense_Mutation	C	T	p.Q257X
READ	TCGA-AG-A002-01	exon_skip_100314	48936951	48937093	48937070	48937070	Nonsense_Mutation	G	T	p.E280X
UCS	TCGA-ND-A4WC-01	exon_skip_100314	48936951	48937093	48937070	48937070	Nonsense_Mutation	G	T	p.E280*
UCS	TCGA-ND-A4WC-01	exon_skip_100314	48936951	48937093	48937070	48937070	Nonsense_Mutation	G	T	p.E280X
LUAD	TCGA-93-A4JN-01	exon_skip_100315	48951054	48951170	48951075	48951075	Nonsense_Mutation	G	T	p.E413*
UCEC	TCGA-BS-A0UV-01	exon_skip_100315	48951054	48951170	48951075	48951075	Nonsense_Mutation	G	T	p.E413*
HNSC	TCGA-IQ-A6SG-01	exon_skip_100315	48951054	48951170	48951141	48951141	Nonsense_Mutation	G	T	p.G435*
GBM	TCGA-06-0140-01	exon_skip_100315	48951054	48951170	48951144	48951144	Nonsense_Mutation	C	T	p.Q436*
LUAD	TCGA-55-6968-01	exon_skip_100315	48951054	48951170	48951166	48951166	Nonsense_Mutation	C	G	p.S443*
GBM	TCGA-06-0188-01	exon_skip_100319	48953730	48953786	48953730	48953730	Nonsense_Mutation	C	T	p.R445_splice
GBM	TCGA-06-0939-01	exon_skip_100319	48953730	48953786	48953730	48953730	Nonsense_Mutation	C	T	p.R445_splice
GBM	TCGA-26-5132-01	exon_skip_100319	48953730	48953786	48953730	48953730	Nonsense_Mutation	C	T	p.R445_splice
SARC	TCGA-IF-A4AJ-01	exon_skip_100319	48953730	48953786	48953730	48953730	Nonsense_Mutation	C	T	p.R445*
BLCA	TCGA-FD-A6TE-01	exon_skip_100319	48953730	48953786	48953760	48953760	Nonsense_Mutation	C	T	p.R455*
BRCA	TCGA-E9-A1RC-01	exon_skip_100319	48953730	48953786	48953760	48953760	Nonsense_Mutation	C	T	p.R455*
SKCM	TCGA-EE-A2MT-06	exon_skip_100319	48953730	48953786	48953760	48953760	Nonsense_Mutation	C	T	p.R455*
UCS	TCGA-NA-A4R1-01	exon_skip_100319	48953730	48953786	48953760	48953760	Nonsense_Mutation	C	T	p.R455*
ACC	TCGA-OR-A5JE-01	exon_skip_100319	48953730	48953786	48953769	48953769	Nonsense_Mutation	G	T	p.E458*
BLCA	TCGA-FD-A5C0-01	exon_skip_100319	48953730	48953786	48953769	48953769	Nonsense_Mutation	G	T	p.E458*
LUAD	TCGA-95-7562-01	exon_skip_100320	49037867	49037971	49037878	49037878	Nonsense_Mutation	T	A	p.C706*
BLCA	TCGA-K4-A54R-01	exon_skip_100320	49037867	49037971	49037966	49037966	Nonsense_Mutation	C	T	p.Q736*
BLCA	TCGA-XF-A9SJ-01	exon_skip_100321	49039134	49039247	49039158	49039158	Nonsense_Mutation	G	T	p.E746*
CESC	TCGA-C5-A1BQ-01	exon_skip_100321	49039134	49039247	49039158	49039158	Nonsense_Mutation	G	T	p.E746*
UCEC	TCGA-BS-A0U9-01	exon_skip_100321	49039134	49039247	49039206	49039206	Nonsense_Mutation	C	T	p.Q762*
BLCA	TCGA-FD-A3B7-01	exon_skip_100321	49039134	49039247	49039215	49039215	Nonsense_Mutation	A	T	p.K765*
BLCA	TCGA-ZF-AA58-01	exon_skip_100321	49039134	49039247	49039230	49039230	Nonsense_Mutation	C	T	p.Q770*
GBM	TCGA-32-2634-01	exon_skip_100321	49039134	49039247	49039230	49039230	Nonsense_Mutation	C	T	p.Q770*
BLCA	TCGA-5N-A9KI-01	exon_skip_100324	49047496	49047526	49047507	49047507	Nonsense_Mutation	C	A	p.S834*
BLCA	TCGA-FD-A3SO-01	exon_skip_100324	49047496	49047526	49047507	49047507	Nonsense_Mutation	C	G	p.S834*
BLCA	TCGA-XF-AAN7-01	exon_skip_100324	49047496	49047526	49047507	49047507	Nonsense_Mutation	C	A	p.S834*
UCS	TCGA-N5-A4RN-01	exon_skip_100313	48881416	48881542	48881414	48881414	Splice_Site	A	G	.
LUAD	TCGA-97-7553-01	exon_skip_100314	48936951	48937093	48937094	48937094	Splice_Site	G	A	p.E287_splice
GBM	TCGA-27-2524-01	exon_skip_100315	48951054	48951170	48951053	48951053	Splice_Site	G	C	p.N406_splice
LIHC	TCGA-ED-A66Y-01	exon_skip_100315	48951054	48951170	48951053	48951053	Splice_Site	G	A	.
LGG	TCGA-DU-5847-01	exon_skip_100319	48953730	48953786	48953728	48953728	Splice_Site	A	G	.
LIHC	TCGA-G3-A25Y-01	exon_skip_100319	48953730	48953786	48953728	48953728	Splice_Site	A	G	.
LUSC	TCGA-66-2783-01	exon_skip_100319	48953730	48953786	48953728	48953728	Splice_Site	A	G	p.R445_splice
SARC	TCGA-DX-A8BG-01	exon_skip_100319	48953730	48953786	48953787	48953787	Splice_Site	G	A	e14+1
LIHC	TCGA-RC-A7S9-01	exon_skip_100319	48953730	48953786	48953788	48953788	Splice_Site	T	C	.
SARC	TCGA-DX-A7EM-01	exon_skip_100320	49037867	49037971	49037972	49037972	Splice_Site	G	A	e21+1

- Depth of coverage in the three exons composing exon skipping event

Depth of coverage in three exons	Mutation description
	Sample: TCGA-EB-A5FP-01
	Cancer type: SKCM
	ESID: exon_skip_100321
	Skipped exon start: 49039134
	Skipped exon end: 49039247
	Mutation start: 49039149
	Mutation end: 49039179
	Mutation type: Frame_Shift_Del
	Reference seq: TTGATCAAAGAAGAGGAGTATGATTCTATTA
	Mutation seq: -
	AAchange: p.LIKEEEYDSII743fs
exon_skip_100321_SKCM_TCGA-EB-A5FP-01.png
	Sample: TCGA-DX-A7EM-01
	Cancer type: SARC
	ESID: exon_skip_100320
	Skipped exon start: 49037867
	Skipped exon end: 49037971
	Mutation start: 49037932
	Mutation end: 49037933
	Mutation type: Frame_Shift_Del
	Reference seq: TG
	Mutation seq: -
	AAchange: p.IV724fs
	Sample: TCGA-DX-A7EM-01
	Cancer type: SARC
	ESID: exon_skip_100320
	Skipped exon start: 49037867
	Skipped exon end: 49037971
	Mutation start: 49037932
	Mutation end: 49037933
	Mutation type: Frame_Shift_Del
	Reference seq: TG
	Mutation seq: -
	AAchange: p.V725fs
	Sample: TCGA-DX-A7EM-01
	Cancer type: SARC
	ESID: exon_skip_100320
	Skipped exon start: 49037867
	Skipped exon end: 49037971
	Mutation start: 49037972
	Mutation end: 49037972
	Mutation type: Splice_Site
	Reference seq: G
	Mutation seq: A
	AAchange: e21+1
exon_skip_100320_SARC_TCGA-DX-A7EM-01.png
	Sample: TCGA-DU-5847-01
	Cancer type: LGG
	ESID: exon_skip_100319
	Skipped exon start: 48953730
	Skipped exon end: 48953786
	Mutation start: 48953728
	Mutation end: 48953728
	Mutation type: Splice_Site
	Reference seq: A
	Mutation seq: G
	AAchange: .
exon_skip_100319LGG_TCGA-DU-5847-01.png
	Sample: TCGA-66-2783-01
	Cancer type: LUSC
	ESID: exon_skip_100319
	Skipped exon start: 48953730
	Skipped exon end: 48953786
	Mutation start: 48953728
	Mutation end: 48953728
	Mutation type: Splice_Site
	Reference seq: A
	Mutation seq: G
	AAchange: p.R445_splice
exon_skip_100319LUSC_TCGA-66-2783-01.png
	Sample: TCGA-DX-A8BG-01
	Cancer type: SARC
	ESID: exon_skip_100319
	Skipped exon start: 48953730
	Skipped exon end: 48953786
	Mutation start: 48953787
	Mutation end: 48953787
	Mutation type: Splice_Site
	Reference seq: G
	Mutation seq: A
	AAchange: e14+1
exon_skip_100319SARC_TCGA-DX-A8BG-01.png
	Sample: TCGA-EE-A2MT-06
	Cancer type: SKCM
	ESID: exon_skip_100319
	Skipped exon start: 48953730
	Skipped exon end: 48953786
	Mutation start: 48953760
	Mutation end: 48953760
	Mutation type: Nonsense_Mutation
	Reference seq: C
	Mutation seq: T
	AAchange: p.R455*
exon_skip_100319SKCM_TCGA-EE-A2MT-06.png
exon_skip_155070_SKCM_TCGA-EE-A2MT-06.png

- Non-synonymous mutations located in the skipped exons in CCLE.

Sample	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
CORL32_LUNG	48881416	48881542	48881468	48881468	Frame_Shift_Del	T	-	p.L64fs
COLO684_ENDOMETRIUM	48881416	48881542	48881489	48881490	Frame_Shift_Del	AG	-	p.R71fs
COLO704_OVARY	48881416	48881542	48881489	48881490	Frame_Shift_Del	AG	-	p.R71fs
NCIH128_LUNG	48951054	48951170	48951087	48951087	Frame_Shift_Del	A	-	p.K417fs
NCIH1304_LUNG	49039134	49039247	49039205	49039205	Frame_Shift_Del	G	-	p.M761fs
NCIH250_LUNG	49047496	49047526	49047524	49047524	Frame_Shift_Del	G	-	p.G840fs
ISTSL2_LUNG	48951054	48951170	48951104	48951105	Frame_Shift_Ins	-	G	p.G423fs
GSU_STOMACH	48881416	48881542	48881483	48881483	Missense_Mutation	C	A	p.H69N
HCC2998_LARGE_INTESTINE	48881416	48881542	48881518	48881518	Missense_Mutation	A	C	p.K80N
DND41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	48951054	48951170	48951099	48951099	Missense_Mutation	G	A	p.D421N
NCIH2110_LUNG	48953730	48953786	48953743	48953743	Missense_Mutation	G	A	p.G449E
OV7_OVARY	49037867	49037971	49037874	49037874	Missense_Mutation	T	C	p.M705T
NCIH209_LUNG	49037867	49037971	49037877	49037877	Missense_Mutation	G	T	p.C706F
HEC251_ENDOMETRIUM	49039134	49039247	49039177	49039177	Missense_Mutation	T	G	p.I752S
SNU1040_LARGE_INTESTINE	49039134	49039247	49039195	49039195	Missense_Mutation	C	T	p.S758L
CHAGOK1_LUNG	49047496	49047526	49047515	49047515	Missense_Mutation	G	A	p.E837K
ESS1_ENDOMETRIUM	48881416	48881542	48881438	48881438	Nonsense_Mutation	G	T	p.E54*
NCIH1963_LUNG	48881416	48881542	48881461	48881461	Nonsense_Mutation	T	A	p.C61*
LU134A_LUNG	48881416	48881542	48881502	48881502	Nonsense_Mutation	G	A	p.W75*
SKPNDW_BONE	48881416	48881542	48881512	48881512	Nonsense_Mutation	G	A	p.W78*
CORL311_LUNG	48881416	48881542	48881523	48881523	Nonsense_Mutation	C	A	p.S82*
LU65_LUNG	48881416	48881542	48881523	48881523	Nonsense_Mutation	C	A	p.S82*
CORL47_LUNG	48881416	48881542	48881534	48881534	Nonsense_Mutation	G	T	p.G86*
NCIH510_LUNG	48936951	48937093	48937025	48937025	Nonsense_Mutation	A	T	p.K265*
COLO668_LUNG	48951054	48951170	48951144	48951144	Nonsense_Mutation	C	T	p.Q436*
U266B1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	48951054	48951170	48951156	48951156	Nonsense_Mutation	G	T	p.E440*
LN405_CENTRAL_NERVOUS_SYSTEM	48953730	48953786	48953760	48953760	Nonsense_Mutation	C	T	p.R455*
639V_URINARY_TRACT	48953730	48953786	48953781	48953781	Nonsense_Mutation	A	T	p.K462*
DU145_PROSTATE	49037867	49037971	49037903	49037903	Nonsense_Mutation	A	T	p.K715*
NCIH69_LUNG	49039134	49039247	49039164	49039164	Nonsense_Mutation	G	T	p.E748*
NCIH2081_LUNG	49039134	49039247	49039190	49039190	Nonsense_Mutation	T	A	p.Y756*
SISO_CERVIX	49047496	49047526	49047507	49047507	Nonsense_Mutation	C	G	p.S834*
SNB75_CENTRAL_NERVOUS_SYSTEM	48936951	48937093	48937093	48937093	Splice_Site	G	A	p.E287E
NO11_CENTRAL_NERVOUS_SYSTEM	48951054	48951170	48951166	48951171	Splice_Site	CACAGG	-	p.SQ443del
NCIH1694_LUNG	48951054	48951170	48951169	48951169	Splice_Site	A	T	p.Q444L
HT3_CERVIX	48951054	48951170	48951169	48951169	Splice_Site	A	G	p.Q444R
639V_URINARY_TRACT	48953730	48953786	48953730	48953730	Splice_Site	C	T	p.R445*
NCIH2196_LUNG	49039134	49039247	49039128	49039134	Splice_Site	CCTCAGA	-	p.L738fs

Top

Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for RB1

sQTL information located at the skipped exons.

Exon skip ID

Chromosome

Three exons

Skippped exon

ENST

Cancer type

SNP id

Location

DNA change (ref/var)

P-value

Top

Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for RB1

Top

Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for RB1

Top

RelatedDrugs for RB1

Approved drugs targeting this gene.
(DrugBank Version 5.1.0 2018-04-02)

Gene	UniProtAcc	DrugBank ID	Drug name	Drug activity	Drug type	Drug status
	P06400	DB00071	Insulin Pork	Retinoblastoma-associated protein	biotech	approved
	P06400	DB00030	Insulin Human	Retinoblastoma-associated protein	biotech	approved\|investigational

Top

RelatedDiseases for RB1

Diseases associated with this gene.
(DisGeNet 4.0)

Gene	Disease ID	Disease name	# pubmeds	Source
RB1	C0035335	Retinoblastoma	9	CTD_human;HPO;UNIPROT
RB1	C1458155	Mammary Neoplasms	3	CTD_human
RB1	C0149925	Small cell carcinoma of lung	2	CTD_human;ORPHANET
RB1	C2239176	Liver carcinoma	2	CTD_human
RB1	C0001624	Adrenal Gland Neoplasms	1	CTD_human
RB1	C0007117	Basal cell carcinoma	1	CTD_human
RB1	C0007131	Non-Small Cell Lung Carcinoma	1	CTD_human
RB1	C0007786	Brain Ischemia	1	CTD_human
RB1	C0023904	Liver Neoplasms, Experimental	1	CTD_human
RB1	C0024667	Animal Mammary Neoplasms	1	CTD_human
RB1	C0024668	Mammary Neoplasms, Experimental	1	CTD_human
RB1	C0027627	Neoplasm Metastasis	1	CTD_human
RB1	C0027659	Neoplasms, Experimental	1	CTD_human
RB1	C0029463	Osteosarcoma	1	CTD_human;HPO
RB1	C0030297	Pancreatic Neoplasm	1	CTD_human
RB1	C0036920	Sezary Syndrome	1	CTD_human
RB1	C0038325	Stevens-Johnson Syndrome	1	CTD_human
RB1	C0206686	Adrenocortical carcinoma	1	CTD_human
RB1	C0279626	Squamous cell carcinoma of esophagus	1	CTD_human
RB1	C1961102	Precursor Cell Lymphoblastic Leukemia Lymphoma	1	CTD_human

	Gene summary
	Gene structures and expression levels
	Exon skipping events with PSIs in TCGA
	Exon skipping events with PSIs in GTEx
	Open reading frame (ORF) annotation in the exon skipping event
	Exon skipping events in the canonical protein sequence
	SNVs in the skipped exons with depth of coverage
	Splicing Quantitative Trait Loci (sQTLs) in the skipped exons
	Splicing Quantitative Trait Methylation (sQTM) in the skipped exon
	Related drugs with this gene
	Related diseases with this gene

Home

Download

Statistics

Landscape

Help

Contact