|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for MNS1 |
 Gene summary |
| Gene information | Gene symbol | MNS1 | Gene ID | 55329 |
| Gene name | meiosis specific nuclear structural 1 | |
| Synonyms | SPATA40 | |
| Cytomap | 15q21.3 | |
| Type of gene | protein-coding | |
| Description | meiosis-specific nuclear structural protein 1spermatogenesis associated 40 | |
| Modification date | 20180523 | |
| UniProtAcc | Q8NEH6 | |
| Context | PubMed: MNS1 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for MNS1 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for MNS1 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for MNS1 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_127446 | 15 | 56736641:56736871:56739038:56739141:56748591:56748719 | 56739038:56739141 | ENSG00000138587.5 | ENST00000260453.3 |
| exon_skip_127449 | 15 | 56739038:56739141:56748591:56748719:56756223:56756445 | 56748591:56748719 | ENSG00000138587.5 | ENST00000260453.3 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for MNS1 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_127446 | 15 | 56736641:56736871:56739038:56739141:56748591:56748719 | 56739038:56739141 | ENSG00000138587.5 | ENST00000260453.3 |
| exon_skip_127449 | 15 | 56739038:56739141:56748591:56748719:56756223:56756445 | 56748591:56748719 | ENSG00000138587.5 | ENST00000260453.3 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for MNS1 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000260453 | 56739038 | 56739141 | Frame-shift |
| ENST00000260453 | 56748591 | 56748719 | Frame-shift |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000260453 | 56739038 | 56739141 | Frame-shift |
| ENST00000260453 | 56748591 | 56748719 | Frame-shift |
Top |
Infer the effects of exon skipping event on protein functional features for MNS1 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
Top |
SNVs in the skipped exons for MNS1 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_127449 | 56748592 | 56748719 | 56748595 | 56748595 | Frame_Shift_Del | T | - | p.N117fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_127449 | 56748592 | 56748719 | 56748619 | 56748619 | Frame_Shift_Del | T | - | p.K109fs |
| UCEC | TCGA-AX-A0J0-01 | exon_skip_127449 | 56748592 | 56748719 | 56748599 | 56748599 | Nonsense_Mutation | C | A | p.E116* |
| UCS | TCGA-ND-A4WC-01 | exon_skip_127449 | 56748592 | 56748719 | 56748695 | 56748695 | Nonsense_Mutation | C | A | p.E84* |
| UCS | TCGA-ND-A4WC-01 | exon_skip_127449 | 56748592 | 56748719 | 56748713 | 56748713 | Nonsense_Mutation | C | A | p.E78* |
| UCEC | TCGA-BS-A0UF-01 | exon_skip_127446 | 56739039 | 56739141 | 56739142 | 56739142 | Splice_Site | C | A | e4-1 |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 56748592 | 56748719 | 56748634 | 56748635 | Frame_Shift_Ins | - | T | p.S104fs |
| CHLA32_BONE | 56739039 | 56739141 | 56739096 | 56739096 | Missense_Mutation | C | T | p.M133I |
| HEC1A_ENDOMETRIUM | 56748592 | 56748719 | 56748661 | 56748661 | Missense_Mutation | A | G | p.M95T |
| HEC1_ENDOMETRIUM | 56748592 | 56748719 | 56748661 | 56748661 | Missense_Mutation | A | G | p.M95T |
| HEC1B_ENDOMETRIUM | 56748592 | 56748719 | 56748661 | 56748661 | Missense_Mutation | A | G | p.M95T |
| SNU81_LARGE_INTESTINE | 56748592 | 56748719 | 56748665 | 56748665 | Missense_Mutation | C | A | p.A94S |
| KYSE410_OESOPHAGUS | 56748592 | 56748719 | 56748700 | 56748700 | Missense_Mutation | A | C | p.L82W |
| HLE_LIVER | 56748592 | 56748719 | 56748705 | 56748705 | Missense_Mutation | C | G | p.K80N |
| LN464_CENTRAL_NERVOUS_SYSTEM | 56748592 | 56748719 | 56748677 | 56748677 | Nonsense_Mutation | C | A | p.E90* |
| LU134A_LUNG | 56748592 | 56748719 | 56748699 | 56748719 | Splice_Site | CAATCTCTTGTTTTCTTCTGC | - | p.AEENKRL76del |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for MNS1 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for MNS1 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for MNS1 |
Top |
RelatedDrugs for MNS1 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for MNS1 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|