|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for PLEKHG6 |
 Gene summary |
| Gene information | Gene symbol | PLEKHG6 | Gene ID | 55200 |
| Gene name | pleckstrin homology and RhoGEF domain containing G6 | |
| Synonyms | MyoGEF | |
| Cytomap | 12p13.31 | |
| Type of gene | protein-coding | |
| Description | pleckstrin homology domain-containing family G member 6PH domain-containing family G member 6myosin II interacting GEFmyosin interacting guanine nucleotide exchange factorpleckstrin homology domain containing, family G (with RhoGef domain) member 6 | |
| Modification date | 20180519 | |
| UniProtAcc | Q3KR16 | |
| Context | PubMed: PLEKHG6 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for PLEKHG6 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for PLEKHG6 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for PLEKHG6 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_79335 | 12 | 6422838:6422950:6424170:6424335:6424719:6424815 | 6424170:6424335 | ENSG00000008323.11 | ENST00000011684.7,ENST00000449001.2,ENST00000396988.3,ENST00000536531.1 |
| exon_skip_79337 | 12 | 6424170:6424335:6424719:6424815:6425034:6425085 | 6424719:6424815 | ENSG00000008323.11 | ENST00000011684.7,ENST00000449001.2,ENST00000396988.3,ENST00000536531.1 |
| exon_skip_79339 | 12 | 6424719:6424815:6425034:6425085:6425420:6425570 | 6425034:6425085 | ENSG00000008323.11 | ENST00000011684.7,ENST00000449001.2,ENST00000396988.3,ENST00000536531.1 |
| exon_skip_79340 | 12 | 6425420:6425570:6426468:6426579:6426712:6426862 | 6426468:6426579 | ENSG00000008323.11 | ENST00000011684.7,ENST00000449001.2,ENST00000396988.3,ENST00000536531.1 |
| exon_skip_79342 | 12 | 6428193:6428274:6435593:6435739:6436419:6437112 | 6435593:6435739 | ENSG00000008323.11 | ENST00000011684.7,ENST00000449001.2,ENST00000396988.3 |
| exon_skip_79345 | 12 | 6428625:6428839:6435593:6435739:6436419:6437112 | 6435593:6435739 | ENSG00000008323.11 | ENST00000304581.8 |
| exon_skip_79347 | 12 | 6435593:6435739:6436419:6437112:6437301:6437651 | 6436419:6437112 | ENSG00000008323.11 | ENST00000011684.7,ENST00000449001.2,ENST00000304581.8,ENST00000396988.3 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for PLEKHG6 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_79335 | 12 | 6422838:6422950:6424170:6424335:6424719:6424815 | 6424170:6424335 | ENSG00000008323.11 | ENST00000011684.7,ENST00000536531.1,ENST00000396988.3,ENST00000449001.2 |
| exon_skip_79337 | 12 | 6424170:6424335:6424719:6424815:6425034:6425085 | 6424719:6424815 | ENSG00000008323.11 | ENST00000011684.7,ENST00000536531.1,ENST00000396988.3,ENST00000449001.2 |
| exon_skip_79340 | 12 | 6425420:6425570:6426468:6426579:6426712:6426862 | 6426468:6426579 | ENSG00000008323.11 | ENST00000011684.7,ENST00000536531.1,ENST00000396988.3,ENST00000449001.2 |
| exon_skip_79342 | 12 | 6428193:6428274:6435593:6435739:6436419:6437112 | 6435593:6435739 | ENSG00000008323.11 | ENST00000011684.7,ENST00000396988.3,ENST00000449001.2 |
| exon_skip_79345 | 12 | 6428625:6428839:6435593:6435739:6436419:6437112 | 6435593:6435739 | ENSG00000008323.11 | ENST00000304581.8 |
| exon_skip_79347 | 12 | 6435593:6435739:6436419:6437112:6437301:6437651 | 6436419:6437112 | ENSG00000008323.11 | ENST00000011684.7,ENST00000396988.3,ENST00000449001.2,ENST00000304581.8 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for PLEKHG6 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000011684 | 6435593 | 6435739 | Frame-shift |
| ENST00000396988 | 6435593 | 6435739 | Frame-shift |
| ENST00000011684 | 6424170 | 6424335 | In-frame |
| ENST00000396988 | 6424170 | 6424335 | In-frame |
| ENST00000011684 | 6424719 | 6424815 | In-frame |
| ENST00000396988 | 6424719 | 6424815 | In-frame |
| ENST00000011684 | 6425034 | 6425085 | In-frame |
| ENST00000396988 | 6425034 | 6425085 | In-frame |
| ENST00000011684 | 6426468 | 6426579 | In-frame |
| ENST00000396988 | 6426468 | 6426579 | In-frame |
| ENST00000011684 | 6436419 | 6437112 | In-frame |
| ENST00000396988 | 6436419 | 6437112 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000011684 | 6435593 | 6435739 | Frame-shift |
| ENST00000396988 | 6435593 | 6435739 | Frame-shift |
| ENST00000011684 | 6424170 | 6424335 | In-frame |
| ENST00000396988 | 6424170 | 6424335 | In-frame |
| ENST00000011684 | 6424719 | 6424815 | In-frame |
| ENST00000396988 | 6424719 | 6424815 | In-frame |
| ENST00000011684 | 6426468 | 6426579 | In-frame |
| ENST00000396988 | 6426468 | 6426579 | In-frame |
| ENST00000011684 | 6436419 | 6437112 | In-frame |
| ENST00000396988 | 6436419 | 6437112 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for PLEKHG6 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000011684 | 2898 | 790 | 6424170 | 6424335 | 443 | 607 | 98 | 153 |
| ENST00000396988 | 2980 | 790 | 6424170 | 6424335 | 525 | 689 | 98 | 153 |
| ENST00000011684 | 2898 | 790 | 6424719 | 6424815 | 608 | 703 | 153 | 185 |
| ENST00000396988 | 2980 | 790 | 6424719 | 6424815 | 690 | 785 | 153 | 185 |
| ENST00000011684 | 2898 | 790 | 6425034 | 6425085 | 704 | 754 | 185 | 202 |
| ENST00000396988 | 2980 | 790 | 6425034 | 6425085 | 786 | 836 | 185 | 202 |
| ENST00000011684 | 2898 | 790 | 6426468 | 6426579 | 905 | 1015 | 252 | 289 |
| ENST00000396988 | 2980 | 790 | 6426468 | 6426579 | 987 | 1097 | 252 | 289 |
| ENST00000011684 | 2898 | 790 | 6436419 | 6437112 | 1819 | 2511 | 557 | 787 |
| ENST00000396988 | 2980 | 790 | 6436419 | 6437112 | 1901 | 2593 | 557 | 787 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000011684 | 2898 | 790 | 6424170 | 6424335 | 443 | 607 | 98 | 153 |
| ENST00000396988 | 2980 | 790 | 6424170 | 6424335 | 525 | 689 | 98 | 153 |
| ENST00000011684 | 2898 | 790 | 6424719 | 6424815 | 608 | 703 | 153 | 185 |
| ENST00000396988 | 2980 | 790 | 6424719 | 6424815 | 690 | 785 | 153 | 185 |
| ENST00000011684 | 2898 | 790 | 6426468 | 6426579 | 905 | 1015 | 252 | 289 |
| ENST00000396988 | 2980 | 790 | 6426468 | 6426579 | 987 | 1097 | 252 | 289 |
| ENST00000011684 | 2898 | 790 | 6436419 | 6437112 | 1819 | 2511 | 557 | 787 |
| ENST00000396988 | 2980 | 790 | 6436419 | 6437112 | 1901 | 2593 | 557 | 787 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q3KR16 | 98 | 153 | 1 | 470 | Alternative sequence | ID=VSP_028856;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15498874;Dbxref=PMID:15498874 |
| Q3KR16 | 98 | 153 | 1 | 470 | Alternative sequence | ID=VSP_028856;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15498874;Dbxref=PMID:15498874 |
| Q3KR16 | 98 | 153 | 1 | 790 | Chain | ID=PRO_0000307912;Note=Pleckstrin homology domain-containing family G member 6 |
| Q3KR16 | 98 | 153 | 1 | 790 | Chain | ID=PRO_0000307912;Note=Pleckstrin homology domain-containing family G member 6 |
| Q3KR16 | 153 | 185 | 1 | 470 | Alternative sequence | ID=VSP_028856;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15498874;Dbxref=PMID:15498874 |
| Q3KR16 | 153 | 185 | 1 | 470 | Alternative sequence | ID=VSP_028856;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15498874;Dbxref=PMID:15498874 |
| Q3KR16 | 153 | 185 | 1 | 790 | Chain | ID=PRO_0000307912;Note=Pleckstrin homology domain-containing family G member 6 |
| Q3KR16 | 153 | 185 | 1 | 790 | Chain | ID=PRO_0000307912;Note=Pleckstrin homology domain-containing family G member 6 |
| Q3KR16 | 153 | 185 | 161 | 353 | Domain | Note=DH;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00062 |
| Q3KR16 | 153 | 185 | 161 | 353 | Domain | Note=DH;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00062 |
| Q3KR16 | 185 | 202 | 1 | 470 | Alternative sequence | ID=VSP_028856;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15498874;Dbxref=PMID:15498874 |
| Q3KR16 | 185 | 202 | 1 | 470 | Alternative sequence | ID=VSP_028856;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15498874;Dbxref=PMID:15498874 |
| Q3KR16 | 185 | 202 | 1 | 790 | Chain | ID=PRO_0000307912;Note=Pleckstrin homology domain-containing family G member 6 |
| Q3KR16 | 185 | 202 | 1 | 790 | Chain | ID=PRO_0000307912;Note=Pleckstrin homology domain-containing family G member 6 |
| Q3KR16 | 185 | 202 | 161 | 353 | Domain | Note=DH;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00062 |
| Q3KR16 | 185 | 202 | 161 | 353 | Domain | Note=DH;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00062 |
| Q3KR16 | 252 | 289 | 1 | 470 | Alternative sequence | ID=VSP_028856;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15498874;Dbxref=PMID:15498874 |
| Q3KR16 | 252 | 289 | 1 | 470 | Alternative sequence | ID=VSP_028856;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15498874;Dbxref=PMID:15498874 |
| Q3KR16 | 252 | 289 | 1 | 790 | Chain | ID=PRO_0000307912;Note=Pleckstrin homology domain-containing family G member 6 |
| Q3KR16 | 252 | 289 | 1 | 790 | Chain | ID=PRO_0000307912;Note=Pleckstrin homology domain-containing family G member 6 |
| Q3KR16 | 252 | 289 | 161 | 353 | Domain | Note=DH;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00062 |
| Q3KR16 | 252 | 289 | 161 | 353 | Domain | Note=DH;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00062 |
| Q3KR16 | 557 | 787 | 1 | 790 | Chain | ID=PRO_0000307912;Note=Pleckstrin homology domain-containing family G member 6 |
| Q3KR16 | 557 | 787 | 1 | 790 | Chain | ID=PRO_0000307912;Note=Pleckstrin homology domain-containing family G member 6 |
| Q3KR16 | 557 | 787 | 714 | 718 | Compositional bias | Note=Poly-Glu |
| Q3KR16 | 557 | 787 | 714 | 718 | Compositional bias | Note=Poly-Glu |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q3KR16 | 98 | 153 | 1 | 470 | Alternative sequence | ID=VSP_028856;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15498874;Dbxref=PMID:15498874 |
| Q3KR16 | 98 | 153 | 1 | 470 | Alternative sequence | ID=VSP_028856;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15498874;Dbxref=PMID:15498874 |
| Q3KR16 | 98 | 153 | 1 | 790 | Chain | ID=PRO_0000307912;Note=Pleckstrin homology domain-containing family G member 6 |
| Q3KR16 | 98 | 153 | 1 | 790 | Chain | ID=PRO_0000307912;Note=Pleckstrin homology domain-containing family G member 6 |
| Q3KR16 | 153 | 185 | 1 | 470 | Alternative sequence | ID=VSP_028856;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15498874;Dbxref=PMID:15498874 |
| Q3KR16 | 153 | 185 | 1 | 470 | Alternative sequence | ID=VSP_028856;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15498874;Dbxref=PMID:15498874 |
| Q3KR16 | 153 | 185 | 1 | 790 | Chain | ID=PRO_0000307912;Note=Pleckstrin homology domain-containing family G member 6 |
| Q3KR16 | 153 | 185 | 1 | 790 | Chain | ID=PRO_0000307912;Note=Pleckstrin homology domain-containing family G member 6 |
| Q3KR16 | 153 | 185 | 161 | 353 | Domain | Note=DH;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00062 |
| Q3KR16 | 153 | 185 | 161 | 353 | Domain | Note=DH;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00062 |
| Q3KR16 | 252 | 289 | 1 | 470 | Alternative sequence | ID=VSP_028856;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15498874;Dbxref=PMID:15498874 |
| Q3KR16 | 252 | 289 | 1 | 470 | Alternative sequence | ID=VSP_028856;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15498874;Dbxref=PMID:15498874 |
| Q3KR16 | 252 | 289 | 1 | 790 | Chain | ID=PRO_0000307912;Note=Pleckstrin homology domain-containing family G member 6 |
| Q3KR16 | 252 | 289 | 1 | 790 | Chain | ID=PRO_0000307912;Note=Pleckstrin homology domain-containing family G member 6 |
| Q3KR16 | 252 | 289 | 161 | 353 | Domain | Note=DH;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00062 |
| Q3KR16 | 252 | 289 | 161 | 353 | Domain | Note=DH;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00062 |
| Q3KR16 | 557 | 787 | 1 | 790 | Chain | ID=PRO_0000307912;Note=Pleckstrin homology domain-containing family G member 6 |
| Q3KR16 | 557 | 787 | 1 | 790 | Chain | ID=PRO_0000307912;Note=Pleckstrin homology domain-containing family G member 6 |
| Q3KR16 | 557 | 787 | 714 | 718 | Compositional bias | Note=Poly-Glu |
| Q3KR16 | 557 | 787 | 714 | 718 | Compositional bias | Note=Poly-Glu |
Top |
SNVs in the skipped exons for PLEKHG6 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| BLCA | TCGA-HQ-A2OF-01 | exon_skip_79335 | 6424171 | 6424335 | 6424295 | 6424305 | Frame_Shift_Del | CCATCGAGAAG | - | p.TIEK108fs |
| BLCA | TCGA-FD-A6TC-01 | exon_skip_79347 | 6436420 | 6437112 | 6436467 | 6436468 | Frame_Shift_Del | AC | - | p.D541fs |
| COAD | TCGA-AD-6895-01 | exon_skip_79347 | 6436420 | 6437112 | 6436855 | 6436856 | Frame_Shift_Del | CT | - | p.702_702del |
| COAD | TCGA-AD-6964-01 | exon_skip_79347 | 6436420 | 6437112 | 6436542 | 6436543 | Frame_Shift_Ins | - | A | p.P598fs |
| LIHC | TCGA-BW-A5NO-01 | exon_skip_79347 | 6436420 | 6437112 | 6436779 | 6436780 | Frame_Shift_Ins | - | A | p.R645fs |
| BLCA | TCGA-FD-A5BX-01 | exon_skip_79342 exon_skip_79345 | 6435594 | 6435739 | 6435720 | 6435720 | Nonsense_Mutation | C | T | p.Q519* |
| HNSC | TCGA-CN-A6V6-01 | exon_skip_79342 exon_skip_79345 | 6435594 | 6435739 | 6435720 | 6435720 | Nonsense_Mutation | C | T | p.Q519* |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| HCT116_LARGE_INTESTINE | 6436420 | 6437112 | 6436757 | 6436759 | In_Frame_Del | GAA | - | p.E671del |
| KARPAS45_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 6424171 | 6424335 | 6424252 | 6424252 | Missense_Mutation | C | G | p.R126G |
| OC316_OVARY | 6424171 | 6424335 | 6424328 | 6424328 | Missense_Mutation | G | T | p.G151V |
| OC314_OVARY | 6424171 | 6424335 | 6424328 | 6424328 | Missense_Mutation | G | T | p.G151V |
| KYSE270_OESOPHAGUS | 6425035 | 6425085 | 6425072 | 6425072 | Missense_Mutation | G | A | p.G198E |
| SNU1040_LARGE_INTESTINE | 6426469 | 6426579 | 6426526 | 6426526 | Missense_Mutation | G | A | p.A272T |
| HEC108_ENDOMETRIUM | 6426469 | 6426579 | 6426562 | 6426562 | Missense_Mutation | T | C | p.F284L |
| SNU407_LARGE_INTESTINE | 6435594 | 6435739 | 6435700 | 6435700 | Missense_Mutation | C | T | p.T544M |
| NB14_AUTONOMIC_GANGLIA | 6436420 | 6437112 | 6436434 | 6436434 | Missense_Mutation | C | T | p.S562L |
| HCC1438_LUNG | 6436420 | 6437112 | 6436512 | 6436512 | Missense_Mutation | C | A | p.S588Y |
| SNU324_PANCREAS | 6436420 | 6437112 | 6436593 | 6436593 | Missense_Mutation | G | A | p.R615Q |
| JURKAT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 6436420 | 6437112 | 6436628 | 6436628 | Missense_Mutation | C | T | p.R627W |
| SNU1040_LARGE_INTESTINE | 6436420 | 6437112 | 6436635 | 6436635 | Missense_Mutation | T | C | p.I629T |
| GP2D_LARGE_INTESTINE | 6436420 | 6437112 | 6436644 | 6436644 | Missense_Mutation | G | A | p.R632H |
| GP5D_LARGE_INTESTINE | 6436420 | 6437112 | 6436644 | 6436644 | Missense_Mutation | G | A | p.R632H |
| LB373EBV_MATCHED_NORMAL_TISSUE | 6436420 | 6437112 | 6436662 | 6436662 | Missense_Mutation | C | A | p.P638H |
| SNU407_LARGE_INTESTINE | 6436420 | 6437112 | 6436686 | 6436686 | Missense_Mutation | C | T | p.A646V |
| LOVO_LARGE_INTESTINE | 6436420 | 6437112 | 6436775 | 6436775 | Missense_Mutation | G | A | p.E676K |
| NCIH1395_LUNG | 6436420 | 6437112 | 6436821 | 6436821 | Missense_Mutation | G | A | p.R691Q |
| MET2B | 6436420 | 6437112 | 6436871 | 6436871 | Missense_Mutation | C | T | p.P708S |
| SNU349_KIDNEY | 6436420 | 6437112 | 6436926 | 6436926 | Missense_Mutation | G | T | p.G726V |
| HS616T_FIBROBLAST | 6436420 | 6437112 | 6436941 | 6436941 | Missense_Mutation | G | A | p.R731H |
| KURAMOCHI_OVARY | 6436420 | 6437112 | 6436941 | 6436941 | Missense_Mutation | G | A | p.R731H |
| KARPAS45_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 6436420 | 6437112 | 6436982 | 6436982 | Missense_Mutation | G | A | p.E745K |
| SNU1_STOMACH | 6436420 | 6437112 | 6437021 | 6437021 | Missense_Mutation | C | T | p.R758W |
| NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 6436420 | 6437112 | 6437033 | 6437033 | Missense_Mutation | C | A | p.P762T |
| NCIH838_LUNG | 6436420 | 6437112 | 6437103 | 6437103 | Missense_Mutation | T | G | p.L785R |
| OC316_OVARY | 6435594 | 6435739 | 6435633 | 6435633 | Nonsense_Mutation | C | T | p.Q522* |
| EGI1_BILIARY_TRACT | 6424171 | 6424335 | 6424330 | 6424349 | Splice_Site | CACAAGGTGAGCCTGAAACT | - | p.HK152fs |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for PLEKHG6 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for PLEKHG6 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for PLEKHG6 |
Top |
RelatedDrugs for PLEKHG6 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for PLEKHG6 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|