|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for HCFC1R1 |
 Gene summary |
| Gene information | Gene symbol | HCFC1R1 | Gene ID | 54985 |
| Gene name | host cell factor C1 regulator 1 | |
| Synonyms | HPIP | |
| Cytomap | 16p13.3 | |
| Type of gene | protein-coding | |
| Description | host cell factor C1 regulator 1HCF-1 beta-propeller-interacting proteinhost cell factor C1 regulator 1 (XPO1 dependent) | |
| Modification date | 20180519 | |
| UniProtAcc | Q9NWW0 | |
| Context | PubMed: HCFC1R1 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for HCFC1R1 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for HCFC1R1 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for HCFC1R1 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_141174 | 16 | 3072918:3072999:3073233:3073362:3073474:3073531 | 3073233:3073362 | ENSG00000103145.6 | ENST00000573842.1,ENST00000574980.1,ENST00000572355.1,ENST00000248089.3,ENST00000396916.1 |
| exon_skip_141178 | 16 | 3072918:3072999:3073233:3073362:3073847:3073962 | 3073233:3073362 | ENSG00000103145.6 | ENST00000574151.1 |
| exon_skip_141187 | 16 | 3072918:3072999:3073233:3073413:3073847:3073962 | 3073233:3073413 | ENSG00000103145.6 | ENST00000354679.3 |
| exon_skip_141192 | 16 | 3072918:3072999:3073233:3073531:3073847:3073962 | 3073233:3073531 | ENSG00000103145.6 | ENST00000573095.1 |
| exon_skip_141199 | 16 | 3072918:3072999:3073233:3073969:3074181:3074216 | 3073233:3073969 | ENSG00000103145.6 | ENST00000576921.1 |
| exon_skip_141221 | 16 | 3073233:3073362:3073474:3073531:3073847:3073962 | 3073474:3073531 | ENSG00000103145.6 | ENST00000573842.1,ENST00000574980.1,ENST00000396916.1 |
| exon_skip_141222 | 16 | 3073233:3073362:3073474:3073531:3074181:3074216 | 3073474:3073531 | ENSG00000103145.6 | ENST00000572355.1 |
| exon_skip_141242 | 16 | 3073474:3073531:3073847:3073969:3074181:3074216 | 3073847:3073969 | ENSG00000103145.6 | ENST00000573842.1,ENST00000396916.1,ENST00000573095.1 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for HCFC1R1 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_141174 | 16 | 3072918:3072999:3073233:3073362:3073474:3073531 | 3073233:3073362 | ENSG00000103145.6 | ENST00000248089.3,ENST00000396916.1,ENST00000572355.1,ENST00000574980.1,ENST00000573842.1 |
| exon_skip_141178 | 16 | 3072918:3072999:3073233:3073362:3073847:3073962 | 3073233:3073362 | ENSG00000103145.6 | ENST00000574151.1 |
| exon_skip_141187 | 16 | 3072918:3072999:3073233:3073413:3073847:3073962 | 3073233:3073413 | ENSG00000103145.6 | ENST00000354679.3 |
| exon_skip_141192 | 16 | 3072918:3072999:3073233:3073531:3073847:3073962 | 3073233:3073531 | ENSG00000103145.6 | ENST00000573095.1 |
| exon_skip_141199 | 16 | 3072918:3072999:3073233:3073969:3074181:3074216 | 3073233:3073969 | ENSG00000103145.6 | ENST00000576921.1 |
| exon_skip_141221 | 16 | 3073233:3073362:3073474:3073531:3073847:3073962 | 3073474:3073531 | ENSG00000103145.6 | ENST00000396916.1,ENST00000574980.1,ENST00000573842.1 |
| exon_skip_141222 | 16 | 3073233:3073362:3073474:3073531:3074181:3074216 | 3073474:3073531 | ENSG00000103145.6 | ENST00000572355.1 |
| exon_skip_141242 | 16 | 3073474:3073531:3073847:3073969:3074181:3074216 | 3073847:3073969 | ENSG00000103145.6 | ENST00000396916.1,ENST00000573095.1,ENST00000573842.1 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for HCFC1R1 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000248089 | 3073233 | 3073362 | In-frame |
| ENST00000574980 | 3073233 | 3073362 | In-frame |
| ENST00000574980 | 3073474 | 3073531 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000248089 | 3073233 | 3073362 | In-frame |
| ENST00000574980 | 3073233 | 3073362 | In-frame |
| ENST00000574980 | 3073474 | 3073531 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for HCFC1R1 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000574980 | 862 | 138 | 3073474 | 3073531 | 337 | 393 | 32 | 50 |
| ENST00000248089 | 982 | 138 | 3073233 | 3073362 | 458 | 586 | 51 | 93 |
| ENST00000574980 | 862 | 138 | 3073233 | 3073362 | 394 | 522 | 51 | 93 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000574980 | 862 | 138 | 3073474 | 3073531 | 337 | 393 | 32 | 50 |
| ENST00000248089 | 982 | 138 | 3073233 | 3073362 | 458 | 586 | 51 | 93 |
| ENST00000574980 | 862 | 138 | 3073233 | 3073362 | 394 | 522 | 51 | 93 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q9NWW0 | 32 | 50 | 32 | 51 | Alternative sequence | ID=VSP_034082;Note=In isoform 2. SSPLRGAVPMSTKRRLEEEQ->R;Ontology_term=ECO:0000303,ECO:0000303;evidence=ECO:0000303|PubMed:12235138,ECO:0000303|PubMed:15489334;Dbxref=PMID:12235138,PMID:15489334 |
| Q9NWW0 | 32 | 50 | 1 | 138 | Chain | ID=PRO_0000338978;Note=Host cell factor C1 regulator 1 |
| Q9NWW0 | 51 | 93 | 32 | 51 | Alternative sequence | ID=VSP_034082;Note=In isoform 2. SSPLRGAVPMSTKRRLEEEQ->R;Ontology_term=ECO:0000303,ECO:0000303;evidence=ECO:0000303|PubMed:12235138,ECO:0000303|PubMed:15489334;Dbxref=PMID:12235138,PMID:15489334 |
| Q9NWW0 | 51 | 93 | 32 | 51 | Alternative sequence | ID=VSP_034082;Note=In isoform 2. SSPLRGAVPMSTKRRLEEEQ->R;Ontology_term=ECO:0000303,ECO:0000303;evidence=ECO:0000303|PubMed:12235138,ECO:0000303|PubMed:15489334;Dbxref=PMID:12235138,PMID:15489334 |
| Q9NWW0 | 51 | 93 | 1 | 138 | Chain | ID=PRO_0000338978;Note=Host cell factor C1 regulator 1 |
| Q9NWW0 | 51 | 93 | 1 | 138 | Chain | ID=PRO_0000338978;Note=Host cell factor C1 regulator 1 |
| Q9NWW0 | 51 | 93 | 76 | 79 | Mutagenesis | Note=Loss of interaction with HCFC1. DHPY->AAPA;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:12235138;Dbxref=PMID:12235138 |
| Q9NWW0 | 51 | 93 | 76 | 79 | Mutagenesis | Note=Loss of interaction with HCFC1. DHPY->AAPA;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:12235138;Dbxref=PMID:12235138 |
| Q9NWW0 | 51 | 93 | 92 | 92 | Natural variant | ID=VAR_043849;Note=P->Q;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:15489334;Dbxref=dbSNP:rs10508,PMID:15489334 |
| Q9NWW0 | 51 | 93 | 92 | 92 | Natural variant | ID=VAR_043849;Note=P->Q;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:15489334;Dbxref=dbSNP:rs10508,PMID:15489334 |
| Q9NWW0 | 51 | 93 | 76 | 79 | Region | Note=Interaction with HCFC1;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:12235138;Dbxref=PMID:12235138 |
| Q9NWW0 | 51 | 93 | 76 | 79 | Region | Note=Interaction with HCFC1;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:12235138;Dbxref=PMID:12235138 |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q9NWW0 | 32 | 50 | 32 | 51 | Alternative sequence | ID=VSP_034082;Note=In isoform 2. SSPLRGAVPMSTKRRLEEEQ->R;Ontology_term=ECO:0000303,ECO:0000303;evidence=ECO:0000303|PubMed:12235138,ECO:0000303|PubMed:15489334;Dbxref=PMID:12235138,PMID:15489334 |
| Q9NWW0 | 32 | 50 | 1 | 138 | Chain | ID=PRO_0000338978;Note=Host cell factor C1 regulator 1 |
| Q9NWW0 | 51 | 93 | 32 | 51 | Alternative sequence | ID=VSP_034082;Note=In isoform 2. SSPLRGAVPMSTKRRLEEEQ->R;Ontology_term=ECO:0000303,ECO:0000303;evidence=ECO:0000303|PubMed:12235138,ECO:0000303|PubMed:15489334;Dbxref=PMID:12235138,PMID:15489334 |
| Q9NWW0 | 51 | 93 | 32 | 51 | Alternative sequence | ID=VSP_034082;Note=In isoform 2. SSPLRGAVPMSTKRRLEEEQ->R;Ontology_term=ECO:0000303,ECO:0000303;evidence=ECO:0000303|PubMed:12235138,ECO:0000303|PubMed:15489334;Dbxref=PMID:12235138,PMID:15489334 |
| Q9NWW0 | 51 | 93 | 1 | 138 | Chain | ID=PRO_0000338978;Note=Host cell factor C1 regulator 1 |
| Q9NWW0 | 51 | 93 | 1 | 138 | Chain | ID=PRO_0000338978;Note=Host cell factor C1 regulator 1 |
| Q9NWW0 | 51 | 93 | 76 | 79 | Mutagenesis | Note=Loss of interaction with HCFC1. DHPY->AAPA;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:12235138;Dbxref=PMID:12235138 |
| Q9NWW0 | 51 | 93 | 76 | 79 | Mutagenesis | Note=Loss of interaction with HCFC1. DHPY->AAPA;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:12235138;Dbxref=PMID:12235138 |
| Q9NWW0 | 51 | 93 | 92 | 92 | Natural variant | ID=VAR_043849;Note=P->Q;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:15489334;Dbxref=dbSNP:rs10508,PMID:15489334 |
| Q9NWW0 | 51 | 93 | 92 | 92 | Natural variant | ID=VAR_043849;Note=P->Q;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:15489334;Dbxref=dbSNP:rs10508,PMID:15489334 |
| Q9NWW0 | 51 | 93 | 76 | 79 | Region | Note=Interaction with HCFC1;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:12235138;Dbxref=PMID:12235138 |
| Q9NWW0 | 51 | 93 | 76 | 79 | Region | Note=Interaction with HCFC1;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:12235138;Dbxref=PMID:12235138 |
Top |
SNVs in the skipped exons for HCFC1R1 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
HCFC1R1_COAD_exon_skip_141192_psi_boxplot.png |
HCFC1R1_COAD_exon_skip_141199_psi_boxplot.png |
HCFC1R1_HNSC_exon_skip_141192_psi_boxplot.png |
HCFC1R1_KIRC_exon_skip_141192_psi_boxplot.png |
HCFC1R1_KIRC_exon_skip_141199_psi_boxplot.png |
HCFC1R1_KIRP_exon_skip_141192_psi_boxplot.png |
HCFC1R1_STAD_exon_skip_141192_psi_boxplot.png |
HCFC1R1_STAD_exon_skip_141199_psi_boxplot.png |
HCFC1R1_UCEC_exon_skip_141192_psi_boxplot.png |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| HNSC | TCGA-F7-A624-01 | exon_skip_141174 exon_skip_141178 | 3073234 | 3073362 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| HNSC | TCGA-F7-A624-01 | exon_skip_141187 | 3073234 | 3073413 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| HNSC | TCGA-F7-A624-01 | exon_skip_141192 | 3073234 | 3073531 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| HNSC | TCGA-F7-A624-01 | exon_skip_141199 | 3073234 | 3073969 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| STAD | TCGA-BR-4201-01 | exon_skip_141174 exon_skip_141178 | 3073234 | 3073362 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84fs |
| STAD | TCGA-BR-4201-01 | exon_skip_141174 exon_skip_141178 | 3073234 | 3073362 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84X |
| STAD | TCGA-BR-4201-01 | exon_skip_141187 | 3073234 | 3073413 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84fs |
| STAD | TCGA-BR-4201-01 | exon_skip_141187 | 3073234 | 3073413 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84X |
| STAD | TCGA-BR-4201-01 | exon_skip_141192 | 3073234 | 3073531 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84fs |
| STAD | TCGA-BR-4201-01 | exon_skip_141192 | 3073234 | 3073531 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84X |
| STAD | TCGA-BR-4201-01 | exon_skip_141199 | 3073234 | 3073969 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84fs |
| STAD | TCGA-BR-4201-01 | exon_skip_141199 | 3073234 | 3073969 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84X |
| STAD | TCGA-BR-8078-01 | exon_skip_141174 exon_skip_141178 | 3073234 | 3073362 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84fs |
| STAD | TCGA-BR-8078-01 | exon_skip_141174 exon_skip_141178 | 3073234 | 3073362 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84X |
| STAD | TCGA-BR-8078-01 | exon_skip_141187 | 3073234 | 3073413 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84fs |
| STAD | TCGA-BR-8078-01 | exon_skip_141187 | 3073234 | 3073413 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84X |
| STAD | TCGA-BR-8078-01 | exon_skip_141192 | 3073234 | 3073531 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84fs |
| STAD | TCGA-BR-8078-01 | exon_skip_141192 | 3073234 | 3073531 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84X |
| STAD | TCGA-BR-8078-01 | exon_skip_141199 | 3073234 | 3073969 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84fs |
| STAD | TCGA-BR-8078-01 | exon_skip_141199 | 3073234 | 3073969 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84X |
| STAD | TCGA-HF-A5NB-01 | exon_skip_141174 exon_skip_141178 | 3073234 | 3073362 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84X |
| STAD | TCGA-HF-A5NB-01 | exon_skip_141174 exon_skip_141178 | 3073234 | 3073362 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| STAD | TCGA-HF-A5NB-01 | exon_skip_141187 | 3073234 | 3073413 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84X |
| STAD | TCGA-HF-A5NB-01 | exon_skip_141187 | 3073234 | 3073413 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| STAD | TCGA-HF-A5NB-01 | exon_skip_141192 | 3073234 | 3073531 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84X |
| STAD | TCGA-HF-A5NB-01 | exon_skip_141192 | 3073234 | 3073531 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| STAD | TCGA-HF-A5NB-01 | exon_skip_141199 | 3073234 | 3073969 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84X |
| STAD | TCGA-HF-A5NB-01 | exon_skip_141199 | 3073234 | 3073969 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| STAD | TCGA-HU-A4GN-01 | exon_skip_141174 exon_skip_141178 | 3073234 | 3073362 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84fs |
| STAD | TCGA-HU-A4GN-01 | exon_skip_141174 exon_skip_141178 | 3073234 | 3073362 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84X |
| STAD | TCGA-HU-A4GN-01 | exon_skip_141187 | 3073234 | 3073413 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84fs |
| STAD | TCGA-HU-A4GN-01 | exon_skip_141187 | 3073234 | 3073413 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84X |
| STAD | TCGA-HU-A4GN-01 | exon_skip_141192 | 3073234 | 3073531 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84fs |
| STAD | TCGA-HU-A4GN-01 | exon_skip_141192 | 3073234 | 3073531 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84X |
| STAD | TCGA-HU-A4GN-01 | exon_skip_141199 | 3073234 | 3073969 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84fs |
| STAD | TCGA-HU-A4GN-01 | exon_skip_141199 | 3073234 | 3073969 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.M84X |
| UCEC | TCGA-B5-A0JR-01 | exon_skip_141174 exon_skip_141178 | 3073234 | 3073362 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| UCEC | TCGA-B5-A0JR-01 | exon_skip_141187 | 3073234 | 3073413 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| UCEC | TCGA-B5-A0JR-01 | exon_skip_141192 | 3073234 | 3073531 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| UCEC | TCGA-B5-A0JR-01 | exon_skip_141199 | 3073234 | 3073969 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| KIRP | TCGA-BQ-7061-01 | exon_skip_141187 | 3073234 | 3073413 | 3073381 | 3073405 | Frame_Shift_Del | GAGGCAGGCTGGGATACTGACACAG | - | p.PVSVSQPAS35fs |
| KIRP | TCGA-BQ-7061-01 | exon_skip_141192 | 3073234 | 3073531 | 3073381 | 3073405 | Frame_Shift_Del | GAGGCAGGCTGGGATACTGACACAG | - | p.PVSVSQPAS35fs |
| KIRP | TCGA-BQ-7061-01 | exon_skip_141199 | 3073234 | 3073969 | 3073381 | 3073405 | Frame_Shift_Del | GAGGCAGGCTGGGATACTGACACAG | - | p.PVSVSQPAS35fs |
| UCS | TCGA-NA-A4QY-01 | exon_skip_141199 | 3073234 | 3073969 | 3073870 | 3073870 | Frame_Shift_Del | C | - | p.V25fs |
| UCS | TCGA-NA-A4QY-01 | exon_skip_141242 | 3073848 | 3073969 | 3073870 | 3073870 | Frame_Shift_Del | C | - | p.V25fs |
| UCS | TCGA-NG-A4VU-01 | exon_skip_141199 | 3073234 | 3073969 | 3073909 | 3073909 | Frame_Shift_Del | G | - | p.Q12fs |
| UCS | TCGA-NG-A4VU-01 | exon_skip_141242 | 3073848 | 3073969 | 3073909 | 3073909 | Frame_Shift_Del | G | - | p.Q12fs |
| COAD | TCGA-A6-5665-01 | exon_skip_141174 exon_skip_141178 | 3073234 | 3073362 | 3073265 | 3073266 | Frame_Shift_Ins | - | GG | p.M65fs |
| COAD | TCGA-A6-5665-01 | exon_skip_141187 | 3073234 | 3073413 | 3073265 | 3073266 | Frame_Shift_Ins | - | GG | p.M65fs |
| COAD | TCGA-A6-5665-01 | exon_skip_141192 | 3073234 | 3073531 | 3073265 | 3073266 | Frame_Shift_Ins | - | GG | p.M65fs |
| COAD | TCGA-A6-5665-01 | exon_skip_141199 | 3073234 | 3073969 | 3073265 | 3073266 | Frame_Shift_Ins | - | GG | p.M65fs |
| KIRC | TCGA-A3-3319-01 | exon_skip_141174 exon_skip_141178 | 3073234 | 3073362 | 3073265 | 3073266 | Frame_Shift_Ins | - | G | p.D84fs |
| KIRC | TCGA-A3-3319-01 | exon_skip_141187 | 3073234 | 3073413 | 3073265 | 3073266 | Frame_Shift_Ins | - | G | p.D84fs |
| KIRC | TCGA-A3-3319-01 | exon_skip_141192 | 3073234 | 3073531 | 3073265 | 3073266 | Frame_Shift_Ins | - | G | p.D84fs |
| KIRC | TCGA-A3-3319-01 | exon_skip_141199 | 3073234 | 3073969 | 3073265 | 3073266 | Frame_Shift_Ins | - | G | p.D84fs |
| COAD | TCGA-A6-6781-01 | exon_skip_141174 exon_skip_141178 | 3073234 | 3073362 | 3073266 | 3073266 | Nonsense_Mutation | G | - | p.M65X |
| COAD | TCGA-A6-6781-01 | exon_skip_141187 | 3073234 | 3073413 | 3073266 | 3073266 | Nonsense_Mutation | G | - | p.M65X |
| COAD | TCGA-A6-6781-01 | exon_skip_141192 | 3073234 | 3073531 | 3073266 | 3073266 | Nonsense_Mutation | G | - | p.M65X |
| COAD | TCGA-A6-6781-01 | exon_skip_141199 | 3073234 | 3073969 | 3073266 | 3073266 | Nonsense_Mutation | G | - | p.M65X |
| COAD | TCGA-G4-6586-01 | exon_skip_141174 exon_skip_141178 | 3073234 | 3073362 | 3073266 | 3073266 | Nonsense_Mutation | G | - | p.M65X |
| COAD | TCGA-G4-6586-01 | exon_skip_141187 | 3073234 | 3073413 | 3073266 | 3073266 | Nonsense_Mutation | G | - | p.M65X |
| COAD | TCGA-G4-6586-01 | exon_skip_141192 | 3073234 | 3073531 | 3073266 | 3073266 | Nonsense_Mutation | G | - | p.M65X |
| COAD | TCGA-G4-6586-01 | exon_skip_141199 | 3073234 | 3073969 | 3073266 | 3073266 | Nonsense_Mutation | G | - | p.M65X |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
 | Sample: TCGA-G4-6586-01 |
| Cancer type: COAD | |
| ESID: exon_skip_141178 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073362 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Nonsense_Mutation | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M65X | |
| Sample: TCGA-G4-6586-01 |
| Cancer type: COAD | |
| ESID: exon_skip_141199 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073969 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Nonsense_Mutation | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M65X | |
| Sample: TCGA-G4-6586-01 |
| Cancer type: COAD | |
| ESID: exon_skip_141192 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073531 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Nonsense_Mutation | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M65X | |
| Sample: TCGA-G4-6586-01 |
| Cancer type: COAD | |
| ESID: exon_skip_141187 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073413 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Nonsense_Mutation | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M65X | |
exon_skip_141199_COAD_TCGA-G4-6586-01.png | |
exon_skip_309975_COAD_TCGA-G4-6586-01.png | |
exon_skip_375541_COAD_TCGA-G4-6586-01.png | |
exon_skip_420494_COAD_TCGA-G4-6586-01.png | |
exon_skip_434965_COAD_TCGA-G4-6586-01.png | |
exon_skip_67402_COAD_TCGA-G4-6586-01.png | |
 | Sample: TCGA-A6-5665-01 |
| Cancer type: COAD | |
| ESID: exon_skip_141178 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073362 | |
| Mutation start: 3073265 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Ins | |
| Reference seq: - | |
| Mutation seq: GG | |
| AAchange: p.M65fs | |
| Sample: TCGA-A6-5665-01 |
| Cancer type: COAD | |
| ESID: exon_skip_141199 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073969 | |
| Mutation start: 3073265 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Ins | |
| Reference seq: - | |
| Mutation seq: GG | |
| AAchange: p.M65fs | |
| Sample: TCGA-A6-5665-01 |
| Cancer type: COAD | |
| ESID: exon_skip_141192 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073531 | |
| Mutation start: 3073265 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Ins | |
| Reference seq: - | |
| Mutation seq: GG | |
| AAchange: p.M65fs | |
| Sample: TCGA-A6-5665-01 |
| Cancer type: COAD | |
| ESID: exon_skip_141187 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073413 | |
| Mutation start: 3073265 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Ins | |
| Reference seq: - | |
| Mutation seq: GG | |
| AAchange: p.M65fs | |
exon_skip_11611_COAD_TCGA-A6-5665-01.png | |
exon_skip_11615_COAD_TCGA-A6-5665-01.png | |
exon_skip_11638_COAD_TCGA-A6-5665-01.png | |
exon_skip_11641_COAD_TCGA-A6-5665-01.png | |
exon_skip_141199_COAD_TCGA-A6-5665-01.png | |
exon_skip_145709_COAD_TCGA-A6-5665-01.png | |
exon_skip_290233_COAD_TCGA-A6-5665-01.png | |
exon_skip_297638_COAD_TCGA-A6-5665-01.png | |
exon_skip_303317_COAD_TCGA-A6-5665-01.png | |
exon_skip_339648_COAD_TCGA-A6-5665-01.png | |
exon_skip_347690_COAD_TCGA-A6-5665-01.png | |
exon_skip_389258_COAD_TCGA-A6-5665-01.png | |
exon_skip_389265_COAD_TCGA-A6-5665-01.png | |
exon_skip_434039_COAD_TCGA-A6-5665-01.png | |
exon_skip_434040_COAD_TCGA-A6-5665-01.png | |
exon_skip_438605_COAD_TCGA-A6-5665-01.png | |
exon_skip_91135_COAD_TCGA-A6-5665-01.png | |
 | Sample: TCGA-HF-A5NB-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141178 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073362 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M84X | |
| Sample: TCGA-HF-A5NB-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141199 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073969 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M84X | |
| Sample: TCGA-HF-A5NB-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141192 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073531 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M84X | |
| Sample: TCGA-HF-A5NB-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141187 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073413 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M84X | |
| Sample: TCGA-HF-A5NB-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141178 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073362 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.P83fs | |
| Sample: TCGA-HF-A5NB-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141199 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073969 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.P83fs | |
| Sample: TCGA-HF-A5NB-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141192 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073531 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.P83fs | |
| Sample: TCGA-HF-A5NB-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141187 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073413 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.P83fs | |
exon_skip_141199_STAD_TCGA-HF-A5NB-01.png | |
exon_skip_20156_STAD_TCGA-HF-A5NB-01.png | |
exon_skip_309972_STAD_TCGA-HF-A5NB-01.png | |
exon_skip_314760_STAD_TCGA-HF-A5NB-01.png | |
exon_skip_314762_STAD_TCGA-HF-A5NB-01.png | |
exon_skip_328008_STAD_TCGA-HF-A5NB-01.png | |
exon_skip_328488_STAD_TCGA-HF-A5NB-01.png | |
exon_skip_343108_STAD_TCGA-HF-A5NB-01.png | |
exon_skip_348822_STAD_TCGA-HF-A5NB-01.png | |
exon_skip_390969_STAD_TCGA-HF-A5NB-01.png | |
exon_skip_39582_STAD_TCGA-HF-A5NB-01.png | |
exon_skip_428975_STAD_TCGA-HF-A5NB-01.png | |
exon_skip_470473_STAD_TCGA-HF-A5NB-01.png | |
exon_skip_93891_STAD_TCGA-HF-A5NB-01.png | |
 | Sample: TCGA-BR-4201-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141178 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073362 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M84X | |
| Sample: TCGA-BR-4201-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141199 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073969 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M84X | |
| Sample: TCGA-BR-4201-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141192 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073531 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M84X | |
| Sample: TCGA-BR-4201-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141187 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073413 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M84X | |
| Sample: TCGA-BR-4201-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141178 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073362 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M84fs | |
| Sample: TCGA-BR-4201-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141199 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073969 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M84fs | |
| Sample: TCGA-BR-4201-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141192 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073531 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M84fs | |
| Sample: TCGA-BR-4201-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141187 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073413 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M84fs | |
exon_skip_141192_STAD_TCGA-BR-4201-01.png | |
exon_skip_16960_STAD_TCGA-BR-4201-01.png | |
exon_skip_326432_STAD_TCGA-BR-4201-01.png | |
exon_skip_337819_STAD_TCGA-BR-4201-01.png | |
exon_skip_345944_STAD_TCGA-BR-4201-01.png | |
exon_skip_345950_STAD_TCGA-BR-4201-01.png | |
exon_skip_351676_STAD_TCGA-BR-4201-01.png | |
exon_skip_454428_STAD_TCGA-BR-4201-01.png | |
exon_skip_454431_STAD_TCGA-BR-4201-01.png | |
exon_skip_454433_STAD_TCGA-BR-4201-01.png | |
exon_skip_45525_STAD_TCGA-BR-4201-01.png | |
exon_skip_456626_STAD_TCGA-BR-4201-01.png | |
exon_skip_494729_STAD_TCGA-BR-4201-01.png | |
exon_skip_60290_STAD_TCGA-BR-4201-01.png | |
exon_skip_60294_STAD_TCGA-BR-4201-01.png | |
 | Sample: TCGA-G4-6586-01 |
| Cancer type: COAD | |
| ESID: exon_skip_141178 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073362 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Nonsense_Mutation | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M65X | |
| Sample: TCGA-G4-6586-01 |
| Cancer type: COAD | |
| ESID: exon_skip_141199 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073969 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Nonsense_Mutation | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M65X | |
| Sample: TCGA-G4-6586-01 |
| Cancer type: COAD | |
| ESID: exon_skip_141192 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073531 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Nonsense_Mutation | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M65X | |
| Sample: TCGA-G4-6586-01 |
| Cancer type: COAD | |
| ESID: exon_skip_141187 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073413 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Nonsense_Mutation | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M65X | |
| exon_skip_141199_COAD_TCGA-G4-6586-01.png | |
| exon_skip_309975_COAD_TCGA-G4-6586-01.png | |
| exon_skip_375541_COAD_TCGA-G4-6586-01.png | |
| exon_skip_420494_COAD_TCGA-G4-6586-01.png | |
| exon_skip_434965_COAD_TCGA-G4-6586-01.png | |
| exon_skip_67402_COAD_TCGA-G4-6586-01.png | |
 | Sample: TCGA-A6-5665-01 |
| Cancer type: COAD | |
| ESID: exon_skip_141178 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073362 | |
| Mutation start: 3073265 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Ins | |
| Reference seq: - | |
| Mutation seq: GG | |
| AAchange: p.M65fs | |
| Sample: TCGA-A6-5665-01 |
| Cancer type: COAD | |
| ESID: exon_skip_141199 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073969 | |
| Mutation start: 3073265 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Ins | |
| Reference seq: - | |
| Mutation seq: GG | |
| AAchange: p.M65fs | |
| Sample: TCGA-A6-5665-01 |
| Cancer type: COAD | |
| ESID: exon_skip_141192 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073531 | |
| Mutation start: 3073265 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Ins | |
| Reference seq: - | |
| Mutation seq: GG | |
| AAchange: p.M65fs | |
| Sample: TCGA-A6-5665-01 |
| Cancer type: COAD | |
| ESID: exon_skip_141187 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073413 | |
| Mutation start: 3073265 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Ins | |
| Reference seq: - | |
| Mutation seq: GG | |
| AAchange: p.M65fs | |
| exon_skip_11611_COAD_TCGA-A6-5665-01.png | |
| exon_skip_11615_COAD_TCGA-A6-5665-01.png | |
| exon_skip_11638_COAD_TCGA-A6-5665-01.png | |
| exon_skip_11641_COAD_TCGA-A6-5665-01.png | |
| exon_skip_141199_COAD_TCGA-A6-5665-01.png | |
| exon_skip_145709_COAD_TCGA-A6-5665-01.png | |
| exon_skip_290233_COAD_TCGA-A6-5665-01.png | |
| exon_skip_297638_COAD_TCGA-A6-5665-01.png | |
| exon_skip_303317_COAD_TCGA-A6-5665-01.png | |
| exon_skip_339648_COAD_TCGA-A6-5665-01.png | |
| exon_skip_347690_COAD_TCGA-A6-5665-01.png | |
| exon_skip_389258_COAD_TCGA-A6-5665-01.png | |
| exon_skip_389265_COAD_TCGA-A6-5665-01.png | |
| exon_skip_434039_COAD_TCGA-A6-5665-01.png | |
| exon_skip_434040_COAD_TCGA-A6-5665-01.png | |
| exon_skip_438605_COAD_TCGA-A6-5665-01.png | |
| exon_skip_91135_COAD_TCGA-A6-5665-01.png | |
 | Sample: TCGA-HF-A5NB-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141178 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073362 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M84X | |
| Sample: TCGA-HF-A5NB-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141199 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073969 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M84X | |
| Sample: TCGA-HF-A5NB-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141192 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073531 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M84X | |
| Sample: TCGA-HF-A5NB-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141187 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073413 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M84X | |
| Sample: TCGA-HF-A5NB-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141178 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073362 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.P83fs | |
| Sample: TCGA-HF-A5NB-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141199 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073969 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.P83fs | |
| Sample: TCGA-HF-A5NB-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141192 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073531 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.P83fs | |
| Sample: TCGA-HF-A5NB-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141187 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073413 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.P83fs | |
| exon_skip_141199_STAD_TCGA-HF-A5NB-01.png | |
| exon_skip_20156_STAD_TCGA-HF-A5NB-01.png | |
| exon_skip_309972_STAD_TCGA-HF-A5NB-01.png | |
| exon_skip_314760_STAD_TCGA-HF-A5NB-01.png | |
| exon_skip_314762_STAD_TCGA-HF-A5NB-01.png | |
| exon_skip_328008_STAD_TCGA-HF-A5NB-01.png | |
| exon_skip_328488_STAD_TCGA-HF-A5NB-01.png | |
| exon_skip_343108_STAD_TCGA-HF-A5NB-01.png | |
| exon_skip_348822_STAD_TCGA-HF-A5NB-01.png | |
| exon_skip_390969_STAD_TCGA-HF-A5NB-01.png | |
| exon_skip_39582_STAD_TCGA-HF-A5NB-01.png | |
| exon_skip_428975_STAD_TCGA-HF-A5NB-01.png | |
| exon_skip_470473_STAD_TCGA-HF-A5NB-01.png | |
| exon_skip_93891_STAD_TCGA-HF-A5NB-01.png | |
 | Sample: TCGA-BR-4201-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141178 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073362 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M84X | |
| Sample: TCGA-BR-4201-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141199 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073969 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M84X | |
| Sample: TCGA-BR-4201-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141192 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073531 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M84X | |
| Sample: TCGA-BR-4201-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141187 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073413 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M84X | |
| Sample: TCGA-BR-4201-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141178 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073362 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M84fs | |
| Sample: TCGA-BR-4201-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141199 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073969 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M84fs | |
| Sample: TCGA-BR-4201-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141192 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073531 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M84fs | |
| Sample: TCGA-BR-4201-01 |
| Cancer type: STAD | |
| ESID: exon_skip_141187 | |
| Skipped exon start: 3073234 | |
| Skipped exon end: 3073413 | |
| Mutation start: 3073266 | |
| Mutation end: 3073266 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.M84fs | |
| exon_skip_141192_STAD_TCGA-BR-4201-01.png | |
| exon_skip_16960_STAD_TCGA-BR-4201-01.png | |
| exon_skip_326432_STAD_TCGA-BR-4201-01.png | |
| exon_skip_337819_STAD_TCGA-BR-4201-01.png | |
| exon_skip_345944_STAD_TCGA-BR-4201-01.png | |
| exon_skip_345950_STAD_TCGA-BR-4201-01.png | |
| exon_skip_351676_STAD_TCGA-BR-4201-01.png | |
| exon_skip_454428_STAD_TCGA-BR-4201-01.png | |
| exon_skip_454431_STAD_TCGA-BR-4201-01.png | |
| exon_skip_454433_STAD_TCGA-BR-4201-01.png | |
| exon_skip_45525_STAD_TCGA-BR-4201-01.png | |
| exon_skip_456626_STAD_TCGA-BR-4201-01.png | |
| exon_skip_494729_STAD_TCGA-BR-4201-01.png | |
| exon_skip_60290_STAD_TCGA-BR-4201-01.png | |
| exon_skip_60294_STAD_TCGA-BR-4201-01.png | |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| DV90_LUNG | 3073234 | 3073362 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| DV90_LUNG | 3073234 | 3073969 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| DV90_LUNG | 3073234 | 3073531 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| DV90_LUNG | 3073234 | 3073413 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| HEC151_ENDOMETRIUM | 3073234 | 3073362 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| HEC151_ENDOMETRIUM | 3073234 | 3073969 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| HEC151_ENDOMETRIUM | 3073234 | 3073531 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| HEC151_ENDOMETRIUM | 3073234 | 3073413 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| SNUC4_LARGE_INTESTINE | 3073234 | 3073362 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| SNUC4_LARGE_INTESTINE | 3073234 | 3073969 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| SNUC4_LARGE_INTESTINE | 3073234 | 3073531 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| SNUC4_LARGE_INTESTINE | 3073234 | 3073413 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| CCK81_LARGE_INTESTINE | 3073234 | 3073362 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| CCK81_LARGE_INTESTINE | 3073234 | 3073969 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| CCK81_LARGE_INTESTINE | 3073234 | 3073531 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| CCK81_LARGE_INTESTINE | 3073234 | 3073413 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| CW2_LARGE_INTESTINE | 3073234 | 3073362 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| CW2_LARGE_INTESTINE | 3073234 | 3073969 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| CW2_LARGE_INTESTINE | 3073234 | 3073531 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| CW2_LARGE_INTESTINE | 3073234 | 3073413 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 3073234 | 3073362 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 3073234 | 3073969 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 3073234 | 3073531 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 3073234 | 3073413 | 3073266 | 3073266 | Frame_Shift_Del | G | - | p.P83fs |
| SNU520_STOMACH | 3073234 | 3073969 | 3073909 | 3073909 | Frame_Shift_Del | G | - | p.Q12fs |
| SNU520_STOMACH | 3073848 | 3073969 | 3073909 | 3073909 | Frame_Shift_Del | G | - | p.Q12fs |
| 22RV1_PROSTATE | 3073234 | 3073969 | 3073888 | 3073888 | Missense_Mutation | G | A | p.P19S |
| 22RV1_PROSTATE | 3073848 | 3073969 | 3073888 | 3073888 | Missense_Mutation | G | A | p.P19S |
| YAMATO_SOFT_TISSUE | 3073234 | 3073969 | 3073907 | 3073907 | Missense_Mutation | C | A | p.Q12H |
| YAMATO_SOFT_TISSUE | 3073848 | 3073969 | 3073907 | 3073907 | Missense_Mutation | C | A | p.Q12H |
| EB3_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 3073234 | 3073969 | 3073917 | 3073917 | Missense_Mutation | C | T | p.R9Q |
| EB3_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 3073848 | 3073969 | 3073917 | 3073917 | Missense_Mutation | C | T | p.R9Q |
| MDAPCA2B_PROSTATE | 3073234 | 3073969 | 3073849 | 3073849 | Splice_Site | T | C | p.S32G |
| MDAPCA2B_PROSTATE | 3073848 | 3073969 | 3073849 | 3073849 | Splice_Site | T | C | p.S32G |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for HCFC1R1 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for HCFC1R1 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for HCFC1R1 |
Top |
RelatedDrugs for HCFC1R1 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for HCFC1R1 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|