|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for POLH |
 Gene summary |
| Gene information | Gene symbol | POLH | Gene ID | 5429 |
| Gene name | DNA polymerase eta | |
| Synonyms | RAD30|RAD30A|XP-V|XPV | |
| Cytomap | 6p21.1 | |
| Type of gene | protein-coding | |
| Description | DNA polymerase etaRAD30 homolog Apolymerase (DNA directed), etapolymerase (DNA) etaxeroderma pigmentosum variant type protein | |
| Modification date | 20180523 | |
| UniProtAcc | Q9Y253 | |
| Context | PubMed: POLH [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| POLH | GO:0000731 | DNA synthesis involved in DNA repair | 17563354 |
| POLH | GO:0010225 | response to UV-C | 17563354 |
Top |
Exon skipping events across known transcript of Ensembl for POLH from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for POLH |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for POLH |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_452182 | 6 | 43544110:43544177:43550052:43550193:43550743:43550843 | 43550052:43550193 | ENSG00000170734.7 | ENST00000372226.1 |
| exon_skip_452184 | 6 | 43544110:43544177:43550743:43550878:43555008:43555137 | 43550743:43550878 | ENSG00000170734.7 | ENST00000443535.1,ENST00000535400.1 |
| exon_skip_452189 | 6 | 43550743:43550878:43555008:43555226:43565432:43565602 | 43555008:43555226 | ENSG00000170734.7 | ENST00000372226.1,ENST00000535400.1,ENST00000372236.4 |
| exon_skip_452194 | 6 | 43555008:43555226:43565432:43565602:43568724:43568828 | 43565432:43565602 | ENSG00000170734.7 | ENST00000372226.1,ENST00000535400.1,ENST00000372236.4 |
| exon_skip_452197 | 6 | 43568724:43568828:43571628:43571748:43572351:43572475 | 43571628:43571748 | ENSG00000170734.7 | ENST00000372226.1,ENST00000535400.1,ENST00000372236.4 |
| exon_skip_452198 | 6 | 43572351:43572475:43572990:43573056:43578290:43578460 | 43572990:43573056 | ENSG00000170734.7 | ENST00000372226.1,ENST00000535400.1,ENST00000372236.4 |
| exon_skip_452199 | 6 | 43572990:43573056:43578290:43578460:43581396:43582458 | 43578290:43578460 | ENSG00000170734.7 | ENST00000535400.1,ENST00000372236.4 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for POLH |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_452182 | 6 | 43544110:43544177:43550052:43550193:43550743:43550843 | 43550052:43550193 | ENSG00000170734.7 | ENST00000372226.1 |
| exon_skip_452184 | 6 | 43544110:43544177:43550743:43550878:43555008:43555137 | 43550743:43550878 | ENSG00000170734.7 | ENST00000535400.1,ENST00000443535.1 |
| exon_skip_452189 | 6 | 43550743:43550878:43555008:43555226:43565432:43565602 | 43555008:43555226 | ENSG00000170734.7 | ENST00000372236.4,ENST00000535400.1,ENST00000372226.1 |
| exon_skip_452194 | 6 | 43555008:43555226:43565432:43565602:43568724:43568828 | 43565432:43565602 | ENSG00000170734.7 | ENST00000372236.4,ENST00000535400.1,ENST00000372226.1 |
| exon_skip_452197 | 6 | 43568724:43568828:43571628:43571748:43572351:43572475 | 43571628:43571748 | ENSG00000170734.7 | ENST00000372236.4,ENST00000535400.1,ENST00000372226.1 |
| exon_skip_452198 | 6 | 43572351:43572475:43572990:43573056:43578290:43578460 | 43572990:43573056 | ENSG00000170734.7 | ENST00000372236.4,ENST00000535400.1,ENST00000372226.1 |
| exon_skip_452199 | 6 | 43572990:43573056:43578290:43578460:43581396:43582458 | 43578290:43578460 | ENSG00000170734.7 | ENST00000372236.4,ENST00000535400.1 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for POLH |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000372236 | 43555008 | 43555226 | Frame-shift |
| ENST00000372236 | 43565432 | 43565602 | Frame-shift |
| ENST00000372236 | 43578290 | 43578460 | Frame-shift |
| ENST00000372236 | 43571628 | 43571748 | In-frame |
| ENST00000372236 | 43572990 | 43573056 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000372236 | 43555008 | 43555226 | Frame-shift |
| ENST00000372236 | 43565432 | 43565602 | Frame-shift |
| ENST00000372236 | 43578290 | 43578460 | Frame-shift |
| ENST00000372236 | 43571628 | 43571748 | In-frame |
| ENST00000372236 | 43572990 | 43573056 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for POLH |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000372236 | 3557 | 713 | 43571628 | 43571748 | 1060 | 1179 | 255 | 294 |
| ENST00000372236 | 3557 | 713 | 43572990 | 43573056 | 1304 | 1369 | 336 | 358 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000372236 | 3557 | 713 | 43571628 | 43571748 | 1060 | 1179 | 255 | 294 |
| ENST00000372236 | 3557 | 713 | 43572990 | 43573056 | 1304 | 1369 | 336 | 358 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q9Y253 | 255 | 294 | 1 | 713 | Chain | ID=PRO_0000173986;Note=DNA polymerase eta |
| Q9Y253 | 255 | 294 | 9 | 259 | Domain | Note=UmuC;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00216 |
| Q9Y253 | 255 | 294 | 261 | 270 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5KFZ |
| Q9Y253 | 255 | 294 | 275 | 280 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5KFZ |
| Q9Y253 | 255 | 294 | 283 | 290 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5KFZ |
| Q9Y253 | 255 | 294 | 292 | 301 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5KFZ |
| Q9Y253 | 255 | 294 | 263 | 263 | Natural variant | ID=VAR_021230;Note=In XPV%3B impairs translesion synthesis. G->V;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:11773631;Dbxref=PMID:11773631 |
| Q9Y253 | 255 | 294 | 266 | 266 | Natural variant | ID=VAR_070837;Note=In XPV. V->D;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:24130121;Dbxref=PMID:24130121 |
| Q9Y253 | 255 | 294 | 256 | 259 | Turn | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:4RNO |
| Q9Y253 | 336 | 358 | 1 | 713 | Chain | ID=PRO_0000173986;Note=DNA polymerase eta |
| Q9Y253 | 336 | 358 | 334 | 359 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5KFZ |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q9Y253 | 255 | 294 | 1 | 713 | Chain | ID=PRO_0000173986;Note=DNA polymerase eta |
| Q9Y253 | 255 | 294 | 9 | 259 | Domain | Note=UmuC;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00216 |
| Q9Y253 | 255 | 294 | 261 | 270 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5KFZ |
| Q9Y253 | 255 | 294 | 275 | 280 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5KFZ |
| Q9Y253 | 255 | 294 | 283 | 290 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5KFZ |
| Q9Y253 | 255 | 294 | 292 | 301 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5KFZ |
| Q9Y253 | 255 | 294 | 263 | 263 | Natural variant | ID=VAR_021230;Note=In XPV%3B impairs translesion synthesis. G->V;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:11773631;Dbxref=PMID:11773631 |
| Q9Y253 | 255 | 294 | 266 | 266 | Natural variant | ID=VAR_070837;Note=In XPV. V->D;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:24130121;Dbxref=PMID:24130121 |
| Q9Y253 | 255 | 294 | 256 | 259 | Turn | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:4RNO |
| Q9Y253 | 336 | 358 | 1 | 713 | Chain | ID=PRO_0000173986;Note=DNA polymerase eta |
| Q9Y253 | 336 | 358 | 334 | 359 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5KFZ |
Top |
SNVs in the skipped exons for POLH |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
POLH_BRCA_exon_skip_452199_psi_boxplot.png |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| STAD | TCGA-CD-A4MJ-01 | exon_skip_452182 | 43550053 | 43550193 | 43550104 | 43550104 | Frame_Shift_Del | T | - | p.C16fs |
| UCS | TCGA-N7-A4Y0-01 | exon_skip_452182 | 43550053 | 43550193 | 43550104 | 43550104 | Frame_Shift_Del | T | - | p.C16fs |
| LUAD | TCGA-69-7979-01 | exon_skip_452184 | 43550744 | 43550878 | 43550832 | 43550832 | Frame_Shift_Del | C | - | p.L77fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_452194 | 43565433 | 43565602 | 43565456 | 43565456 | Frame_Shift_Del | T | - | p.F172fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_452194 | 43565433 | 43565602 | 43565569 | 43565569 | Frame_Shift_Del | T | - | p.G209fs |
| BLCA | TCGA-UY-A78N-01 | exon_skip_452199 | 43578291 | 43578460 | 43578415 | 43578439 | Frame_Shift_Del | TTACTGTCATCAAGAACTGTAATAC | - | p.FTVIKNCNT400fs |
| LIHC | TCGA-BC-A112-01 | exon_skip_452197 | 43571629 | 43571748 | 43571734 | 43571735 | Frame_Shift_Ins | - | G | p.LG290fs |
| STAD | TCGA-CD-A487-01 | exon_skip_452197 | 43571629 | 43571748 | 43571749 | 43571749 | Splice_Site | G | C | . |
| STAD | TCGA-CD-A487-01 | exon_skip_452197 | 43571629 | 43571748 | 43571749 | 43571749 | Splice_Site | G | C | p.G295_splice |
| BRCA | TCGA-A2-A04R-01 | exon_skip_452199 | 43578291 | 43578460 | 43578461 | 43578461 | Splice_Site | G | T | e9+1 |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
 | Sample: TCGA-A2-A04R-01 |
| Cancer type: BRCA | |
| ESID: exon_skip_452199 | |
| Skipped exon start: 43578291 | |
| Skipped exon end: 43578460 | |
| Mutation start: 43578461 | |
| Mutation end: 43578461 | |
| Mutation type: Splice_Site | |
| Reference seq: G | |
| Mutation seq: T | |
| AAchange: e9+1 | |
exon_skip_452199_BRCA_TCGA-A2-A04R-01.png | |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| HEC151_ENDOMETRIUM | 43550053 | 43550193 | 43550104 | 43550104 | Frame_Shift_Del | T | - | p.C16fs |
| JURKAT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 43550053 | 43550193 | 43550104 | 43550104 | Frame_Shift_Del | T | - | p.C16fs |
| SNU175_LARGE_INTESTINE | 43550053 | 43550193 | 43550104 | 43550104 | Frame_Shift_Del | T | - | p.C16fs |
| NUGC3_STOMACH | 43550053 | 43550193 | 43550104 | 43550104 | Frame_Shift_Del | T | - | p.C16fs |
| SNU1_STOMACH | 43550053 | 43550193 | 43550104 | 43550104 | Frame_Shift_Del | T | - | p.C16fs |
| HEC1_ENDOMETRIUM | 43550744 | 43550878 | 43550859 | 43550859 | Frame_Shift_Del | G | - | p.G85fs |
| MFE319_ENDOMETRIUM | 43550053 | 43550193 | 43550103 | 43550104 | Frame_Shift_Ins | - | T | p.CF16fs |
| HEC108_ENDOMETRIUM | 43550053 | 43550193 | 43550063 | 43550063 | Missense_Mutation | A | G | p.T3A |
| SNU81_LARGE_INTESTINE | 43550053 | 43550193 | 43550094 | 43550094 | Missense_Mutation | A | G | p.D13G |
| FEPD_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 43550053 | 43550193 | 43550175 | 43550175 | Missense_Mutation | A | T | p.K40I |
| SW480_LARGE_INTESTINE | 43550053 | 43550193 | 43550186 | 43550186 | Missense_Mutation | G | T | p.G44C |
| SNU349_KIDNEY | 43550744 | 43550878 | 43550800 | 43550800 | Missense_Mutation | C | T | p.A65V |
| KARPAS45_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 43550744 | 43550878 | 43550826 | 43550826 | Missense_Mutation | G | A | p.D74N |
| RCM1_LARGE_INTESTINE | 43550744 | 43550878 | 43550848 | 43550848 | Missense_Mutation | G | A | p.R81H |
| PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 43555009 | 43555226 | 43555022 | 43555022 | Missense_Mutation | A | G | p.S96G |
| HCT116_LARGE_INTESTINE | 43555009 | 43555226 | 43555070 | 43555070 | Missense_Mutation | G | A | p.A112T |
| CAMA1_BREAST | 43555009 | 43555226 | 43555178 | 43555178 | Missense_Mutation | G | A | p.E148K |
| HCC1395_BREAST | 43555009 | 43555226 | 43555194 | 43555194 | Missense_Mutation | G | A | p.G153D |
| NB14_AUTONOMIC_GANGLIA | 43565433 | 43565602 | 43565531 | 43565531 | Missense_Mutation | G | A | p.V197M |
| JURKAT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 43571629 | 43571748 | 43571631 | 43571631 | Missense_Mutation | G | A | p.R256H |
| HCC1569_BREAST | 43571629 | 43571748 | 43571640 | 43571640 | Missense_Mutation | G | A | p.G259E |
| BICR18_UPPER_AERODIGESTIVE_TRACT | 43571629 | 43571748 | 43571695 | 43571695 | Missense_Mutation | A | C | p.E277D |
| G402_SOFT_TISSUE | 43572991 | 43573056 | 43573049 | 43573049 | Missense_Mutation | G | A | p.R356Q |
| HEC59_ENDOMETRIUM | 43578291 | 43578460 | 43578370 | 43578370 | Missense_Mutation | G | A | p.C385Y |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for POLH |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for POLH |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for POLH |
Top |
RelatedDrugs for POLH |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for POLH |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| POLH | C1848410 | Xeroderma pigmentosum, variant type | 3 | CTD_human;ORPHANET;UNIPROT |
| POLH | C0043346 | Xeroderma Pigmentosum | 1 | CTD_human |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|