|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for CPSF2 |
 Gene summary |
| Gene information | Gene symbol | CPSF2 | Gene ID | 53981 |
| Gene name | cleavage and polyadenylation specific factor 2 | |
| Synonyms | CPSF100 | |
| Cytomap | 14q32.12 | |
| Type of gene | protein-coding | |
| Description | cleavage and polyadenylation specificity factor subunit 2CPSF 100 kDa subunitCPSF 100kDa subunitcleavage and polyadenylation specific factor 2, 100kDacleavage and polyadenylation specificity factor 100 kDa subunit | |
| Modification date | 20180522 | |
| UniProtAcc | Q9P2I0 | |
| Context | PubMed: CPSF2 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| CPSF2 | GO:0006398 | mRNA 3'-end processing by stem-loop binding and cleavage | 18688255 |
Top |
Exon skipping events across known transcript of Ensembl for CPSF2 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for CPSF2 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for CPSF2 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_109003 | 14 | 92588328:92588472:92592465:92592524:92597294:92597477 | 92592465:92592524 | ENSG00000165934.8 | ENST00000554290.1 |
| exon_skip_109008 | 14 | 92597294:92597477:92600354:92600514:92600593:92600699 | 92600354:92600514 | ENSG00000165934.8 | ENST00000298875.4 |
| exon_skip_109009 | 14 | 92604575:92604691:92608507:92608695:92609347:92609638 | 92608507:92608695 | ENSG00000165934.8 | ENST00000298875.4 |
| exon_skip_109012 | 14 | 92621522:92621667:92622822:92622975:92624002:92624228 | 92622822:92622975 | ENSG00000165934.8 | ENST00000298875.4 |
| exon_skip_109013 | 14 | 92624002:92624228:92625326:92625626:92627455:92627590 | 92625326:92625626 | ENSG00000165934.8 | ENST00000298875.4,ENST00000555244.1 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for CPSF2 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_109003 | 14 | 92588328:92588472:92592465:92592524:92597294:92597477 | 92592465:92592524 | ENSG00000165934.8 | ENST00000554290.1 |
| exon_skip_109008 | 14 | 92597294:92597477:92600354:92600514:92600593:92600699 | 92600354:92600514 | ENSG00000165934.8 | ENST00000298875.4 |
| exon_skip_109009 | 14 | 92604575:92604691:92608507:92608695:92609347:92609638 | 92608507:92608695 | ENSG00000165934.8 | ENST00000298875.4 |
| exon_skip_109012 | 14 | 92621522:92621667:92622822:92622975:92624002:92624228 | 92622822:92622975 | ENSG00000165934.8 | ENST00000298875.4 |
| exon_skip_109013 | 14 | 92624002:92624228:92625326:92625626:92627455:92627590 | 92625326:92625626 | ENSG00000165934.8 | ENST00000298875.4,ENST00000555244.1 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for CPSF2 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000298875 | 92600354 | 92600514 | Frame-shift |
| ENST00000298875 | 92608507 | 92608695 | Frame-shift |
| ENST00000298875 | 92622822 | 92622975 | In-frame |
| ENST00000298875 | 92625326 | 92625626 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000298875 | 92600354 | 92600514 | Frame-shift |
| ENST00000298875 | 92608507 | 92608695 | Frame-shift |
| ENST00000298875 | 92622822 | 92622975 | In-frame |
| ENST00000298875 | 92625326 | 92625626 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for CPSF2 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000298875 | 5318 | 782 | 92622822 | 92622975 | 1728 | 1880 | 481 | 531 |
| ENST00000298875 | 5318 | 782 | 92625326 | 92625626 | 2107 | 2406 | 607 | 707 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000298875 | 5318 | 782 | 92622822 | 92622975 | 1728 | 1880 | 481 | 531 |
| ENST00000298875 | 5318 | 782 | 92625326 | 92625626 | 2107 | 2406 | 607 | 707 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q9P2I0 | 481 | 531 | 1 | 782 | Chain | ID=PRO_0000074393;Note=Cleavage and polyadenylation specificity factor subunit 2 |
| Q9P2I0 | 607 | 707 | 1 | 782 | Chain | ID=PRO_0000074393;Note=Cleavage and polyadenylation specificity factor subunit 2 |
| Q9P2I0 | 607 | 707 | 660 | 660 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:18669648;Dbxref=PMID:18669648 |
| Q9P2I0 | 607 | 707 | 654 | 654 | Sequence conflict | Note=K->R;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q9P2I0 | 481 | 531 | 1 | 782 | Chain | ID=PRO_0000074393;Note=Cleavage and polyadenylation specificity factor subunit 2 |
| Q9P2I0 | 607 | 707 | 1 | 782 | Chain | ID=PRO_0000074393;Note=Cleavage and polyadenylation specificity factor subunit 2 |
| Q9P2I0 | 607 | 707 | 660 | 660 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:18669648;Dbxref=PMID:18669648 |
| Q9P2I0 | 607 | 707 | 654 | 654 | Sequence conflict | Note=K->R;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
Top |
SNVs in the skipped exons for CPSF2 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_109008 | 92600355 | 92600514 | 92600439 | 92600439 | Frame_Shift_Del | G | - | p.L78fs |
| LIHC | TCGA-2Y-A9HA-01 | exon_skip_109013 | 92625327 | 92625626 | 92625383 | 92625414 | Frame_Shift_Del | TGAATTAGCTTGGATAGATGGTGTCTTAGATA | - | p.626_636del |
| SKCM | TCGA-EE-A29M-06 | exon_skip_109013 | 92625327 | 92625626 | 92625548 | 92625549 | Frame_Shift_Del | TC | - | p.681_681del |
| SKCM | TCGA-EE-A29M-06 | exon_skip_109013 | 92625327 | 92625626 | 92625548 | 92625549 | Frame_Shift_Del | TC | - | p.SL681fs |
| BLCA | TCGA-DK-A6AW-01 | exon_skip_109009 | 92608508 | 92608695 | 92608528 | 92608528 | Nonsense_Mutation | C | T | p.R228* |
| KIRC | TCGA-A3-A8OU-01 | exon_skip_109009 | 92608508 | 92608695 | 92608577 | 92608577 | Nonsense_Mutation | T | A | p.L244X |
| CESC | TCGA-FU-A2QG-01 | exon_skip_109013 | 92625327 | 92625626 | 92625343 | 92625343 | Nonsense_Mutation | C | G | p.S613* |
| HNSC | TCGA-CR-7374-01 | exon_skip_109013 | 92625327 | 92625626 | 92625450 | 92625450 | Nonsense_Mutation | G | T | p.E649* |
| LUAD | TCGA-91-6849-01 | exon_skip_109013 | 92625327 | 92625626 | 92625582 | 92625582 | Nonsense_Mutation | G | T | p.E693* |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| SEKI_SKIN | 92600355 | 92600514 | 92600386 | 92600399 | Frame_Shift_Del | TCTCACCCTGATCC | - | p.SHPDP61fs |
| NCIH146_LUNG | 92600355 | 92600514 | 92600432 | 92600432 | Missense_Mutation | G | T | p.G76V |
| HS578T_BREAST | 92622823 | 92622975 | 92622941 | 92622941 | Missense_Mutation | A | G | p.K521E |
| SNU423_LIVER | 92625327 | 92625626 | 92625411 | 92625411 | Missense_Mutation | G | T | p.D636Y |
| KMM1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 92625327 | 92625626 | 92625462 | 92625462 | Missense_Mutation | C | A | p.L653I |
| FARAGE_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 92625327 | 92625626 | 92625496 | 92625496 | Missense_Mutation | T | C | p.V664A |
| MELHO_SKIN | 92625327 | 92625626 | 92625600 | 92625600 | Missense_Mutation | A | G | p.T699A |
| HEC251_ENDOMETRIUM | 92608508 | 92608695 | 92608528 | 92608528 | Nonsense_Mutation | C | T | p.R228* |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for CPSF2 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for CPSF2 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for CPSF2 |
Top |
RelatedDrugs for CPSF2 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for CPSF2 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|