ExonSkipDB: functional annotation of exon skipping event in human

Gene summary for PKD2

Gene summary

Gene information	Gene symbol	PKD2
	Gene ID	5311
	Gene name	polycystin 2, transient receptor potential cation channel
	Synonyms	APKD2\|PC2\|PKD4\|Pc-2\|TRPP2
	Cytomap	4q22.1
	Type of gene	protein-coding
	Description	polycystin-2autosomal dominant polycystic kidney disease type II proteinpolycystic kidney disease 2 (autosomal dominant)transient receptor potential cation channel subfamily P member 2
	Modification date	20180523
	UniProtAcc	Q13563
	Context	PubMed: PKD2 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID)

Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Gene	GO ID	GO term	PubMed ID
PKD2	GO:0006816	calcium ion transport	11252306
PKD2	GO:0031659	positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle	16311606
PKD2	GO:0035725	sodium ion transmembrane transport	11252306
PKD2	GO:0045944	positive regulation of transcription by RNA polymerase II	16311606
PKD2	GO:0051209	release of sequestered calcium ion into cytosol	11854751
PKD2	GO:0051289	protein homotetramerization	28092368
PKD2	GO:0070588	calcium ion transmembrane transport	11854751
PKD2	GO:0071464	cellular response to hydrostatic pressure	16025301
PKD2	GO:0071470	cellular response to osmotic stress	16025301
PKD2	GO:0071805	potassium ion transmembrane transport	26269590
PKD2	GO:0090279	regulation of calcium ion import	11854751

Top

Exon skipping events across known transcript of Ensembl for PKD2 from UCSC genome browser

Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure.
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Gene isoform structures and expression levels for PKD2

Expression levels of gene isoforms across TCGA.

Expression levels of gene isoforms across GTEx.

Top

Exon skipping events with PSIs in TCGA for PKD2

Information of exkip skipping event in TCGA.

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_424939	4	88959402:88959653:88964384:88964609:88967793:88968022	88964384:88964609	ENSG00000118762.3	ENST00000237596.2
exon_skip_424948	4	88964412:88964609:88967793:88968022:88973142:88973310	88967793:88968022	ENSG00000118762.3	ENST00000237596.2
exon_skip_424952	4	88967793:88968022:88973142:88973310:88977237:88977419	88973142:88973310	ENSG00000118762.3	ENST00000237596.2
exon_skip_424953	4	88977237:88977419:88979134:88979255:88983057:88983156	88979134:88979255	ENSG00000118762.3	ENST00000508588.1,ENST00000502363.1,ENST00000237596.2
exon_skip_424956	4	88977237:88977419:88983057:88983156:88986525:88986647	88983057:88983156	ENSG00000118762.3	ENST00000512858.1,ENST00000511337.1
exon_skip_424957	4	88979134:88979255:88983057:88983156:88986525:88986647	88983057:88983156	ENSG00000118762.3	ENST00000508588.1,ENST00000502363.1,ENST00000237596.2
exon_skip_424960	4	88986913:88987031:88989049:88989213:88995963:88996111	88989049:88989213	ENSG00000118762.3	ENST00000508588.1,ENST00000502363.1,ENST00000512858.1,ENST00000511337.1,ENST00000237596.2

PSI values of skipped exons in TCGA.

Top

Exon skipping events with PSIs in GTEx for PKD2

Information of exkip skipping event in GTEx

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_424939	4	88959402:88959653:88964384:88964609:88967793:88968022	88964384:88964609	ENSG00000118762.3	ENST00000237596.2
exon_skip_424948	4	88964412:88964609:88967793:88968022:88973142:88973310	88967793:88968022	ENSG00000118762.3	ENST00000237596.2
exon_skip_424952	4	88967793:88968022:88973142:88973310:88977237:88977419	88973142:88973310	ENSG00000118762.3	ENST00000237596.2
exon_skip_424953	4	88977237:88977419:88979134:88979255:88983057:88983156	88979134:88979255	ENSG00000118762.3	ENST00000237596.2,ENST00000508588.1,ENST00000502363.1
exon_skip_424956	4	88977237:88977419:88983057:88983156:88986525:88986647	88983057:88983156	ENSG00000118762.3	ENST00000511337.1,ENST00000512858.1
exon_skip_424957	4	88979134:88979255:88983057:88983156:88986525:88986647	88983057:88983156	ENSG00000118762.3	ENST00000237596.2,ENST00000508588.1,ENST00000502363.1
exon_skip_424960	4	88986913:88987031:88989049:88989213:88995963:88996111	88989049:88989213	ENSG00000118762.3	ENST00000237596.2,ENST00000508588.1,ENST00000511337.1,ENST00000512858.1,ENST00000502363.1

PSI values of skipped exons in GTEx.

* Skipped exon sequences.

Top

Open reading frame (ORF) annotation in the exon skipping event for PKD2

Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms.

ENST	Start of skipped exon	End of skipped exon	ORF
ENST00000237596	88967793	88968022	Frame-shift
ENST00000237596	88979134	88979255	Frame-shift
ENST00000237596	88989049	88989213	Frame-shift
ENST00000237596	88964384	88964609	In-frame
ENST00000237596	88973142	88973310	In-frame
ENST00000237596	88983057	88983156	In-frame

Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms.

ENST	Start of skipped exon	End of skipped exon	ORF
ENST00000237596	88967793	88968022	Frame-shift
ENST00000237596	88979134	88979255	Frame-shift
ENST00000237596	88989049	88989213	Frame-shift
ENST00000237596	88964384	88964609	In-frame
ENST00000237596	88973142	88973310	In-frame
ENST00000237596	88983057	88983156	In-frame

Top

Infer the effects of exon skipping event on protein functional features for PKD2

Exon skipping at the protein sequence level and followed lost functional features.
* Click on the image to enlarge it in a new window.

Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases.

ENST	Length of mRNA	Length of AA seq.	Genomic start	Genomic end	mRNA start	mRNA end	AA start	AA end
ENST00000237596	5073	968	88964384	88964609	1161	1385	365	439
ENST00000237596	5073	968	88973142	88973310	1615	1782	516	572
ENST00000237596	5073	968	88983057	88983156	2086	2184	673	706

Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases.

ENST	Length of mRNA	Length of AA seq.	Genomic start	Genomic end	mRNA start	mRNA end	AA start	AA end
ENST00000237596	5073	968	88964384	88964609	1161	1385	365	439
ENST00000237596	5073	968	88973142	88973310	1615	1782	516	572
ENST00000237596	5073	968	88983057	88983156	2086	2184	673	706

Lost protein functional features of individual exon skipping events in TCGA.

UniProt acc.	Start of exon skipping (AA)	End of exon skipping (AA)	Protein feature start (AA)	Protein feature end (AA)	Category of protein feature	Description of feature
Q13563	365	439	390	394	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	365	439	419	430	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	365	439	435	444	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	365	439	1	968	Chain	ID=PRO_0000164356;Note=Polycystin-2
Q13563	365	439	375	375	Glycosylation	Note=N-linked (GlcNAc...) asparagine;Ontology_term=ECO:0000269,ECO:0000269,ECO:0000269;evidence=ECO:0000269\|PubMed:27768895,ECO:0000269\|PubMed:27991905,ECO:0000269\|PubMed:28092368;Dbxref=PMID:27768895,PMID:27991905,PMID:28092368
Q13563	365	439	399	411	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	365	439	384	384	Natural variant	ID=VAR_064394;Note=In PKD2. A->P;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:21115670;Dbxref=PMID:21115670
Q13563	365	439	414	414	Natural variant	ID=VAR_009195;Note=In PKD2%3B affects channel activity as it is able to abolish channel currents induced by the gain-of-function artificial mutant P-604. W->G;Ontology_term=ECO:0000269,ECO:0000269,ECO:0000269;evidence=ECO:0000269\|PubMed:12707387,ECO:00002
Q13563	365	439	420	420	Natural variant	ID=VAR_058825;Note=In PKD2%3B affects channel activity as it is able to abolish channel currents induced by the gain-of-function artificial mutant P-604. R->G;Ontology_term=ECO:0000269,ECO:0000269;evidence=ECO:0000269\|PubMed:14993477,ECO:0000269\|PubMed:27
Q13563	365	439	242	468	Topological domain	Note=Extracellular;Ontology_term=ECO:0000269,ECO:0000269,ECO:0000269;evidence=ECO:0000269\|PubMed:27768895,ECO:0000269\|PubMed:27991905,ECO:0000269\|PubMed:28092368;Dbxref=PMID:27768895,PMID:27991905,PMID:28092368
Q13563	365	439	364	366	Turn	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	365	439	371	373	Turn	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	365	439	431	434	Turn	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	516	572	484	968	Alternative sequence	ID=VSP_042480;Note=In isoform 2. Missing;Ontology_term=ECO:0000305;evidence=ECO:0000305
Q13563	516	572	517	572	Alternative sequence	ID=VSP_042481;Note=In isoform 3. Missing;Ontology_term=ECO:0000305;evidence=ECO:0000305
Q13563	516	572	1	968	Chain	ID=PRO_0000164356;Note=Polycystin-2
Q13563	516	572	506	527	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	516	572	533	540	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	516	572	549	571	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	516	572	572	579	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	516	572	527	552	Topological domain	Note=Extracellular;Ontology_term=ECO:0000269,ECO:0000269,ECO:0000269;evidence=ECO:0000269\|PubMed:27768895,ECO:0000269\|PubMed:27991905,ECO:0000269\|PubMed:28092368;Dbxref=PMID:27768895,PMID:27991905,PMID:28092368
Q13563	516	572	506	526	Transmembrane	Note=Helical%3B Name%3DS3;Ontology_term=ECO:0000269,ECO:0000269,ECO:0000269;evidence=ECO:0000269\|PubMed:27768895,ECO:0000269\|PubMed:27991905,ECO:0000269\|PubMed:28092368;Dbxref=PMID:27768895,PMID:27991905,PMID:28092368
Q13563	516	572	553	573	Transmembrane	Note=Helical%3B Name%3DS4;Ontology_term=ECO:0000269,ECO:0000269,ECO:0000269;evidence=ECO:0000269\|PubMed:27768895,ECO:0000269\|PubMed:27991905,ECO:0000269\|PubMed:28092368;Dbxref=PMID:27768895,PMID:27991905,PMID:28092368
Q13563	516	572	528	530	Turn	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	673	706	484	968	Alternative sequence	ID=VSP_042480;Note=In isoform 2. Missing;Ontology_term=ECO:0000305;evidence=ECO:0000305
Q13563	673	706	647	968	Alternative sequence	ID=VSP_042483;Note=In isoform 4. Missing;Ontology_term=ECO:0000305;evidence=ECO:0000305
Q13563	673	706	1	968	Chain	ID=PRO_0000164356;Note=Polycystin-2
Q13563	673	706	673	692	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	673	706	684	684	Natural variant	ID=VAR_011076;Note=In PKD2%3B somatic mutation. Missing;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:10835625;Dbxref=PMID:10835625
Q13563	673	706	676	968	Topological domain	Note=Cytoplasmic;Ontology_term=ECO:0000269,ECO:0000269,ECO:0000269;evidence=ECO:0000269\|PubMed:27768895,ECO:0000269\|PubMed:27991905,ECO:0000269\|PubMed:28092368;Dbxref=PMID:27768895,PMID:27991905,PMID:28092368
Q13563	673	706	655	675	Transmembrane	Note=Helical%3B Name%3DS6;Ontology_term=ECO:0000269,ECO:0000269,ECO:0000269;evidence=ECO:0000269\|PubMed:27768895,ECO:0000269\|PubMed:27991905,ECO:0000269\|PubMed:28092368;Dbxref=PMID:27768895,PMID:27991905,PMID:28092368

Lost protein functional features of individual exon skipping events in GTEx.

UniProt acc.	Start of exon skipping (AA)	End of exon skipping (AA)	Protein feature start (AA)	Protein feature end (AA)	Category of protein feature	Description of feature
Q13563	365	439	390	394	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	365	439	419	430	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	365	439	435	444	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	365	439	1	968	Chain	ID=PRO_0000164356;Note=Polycystin-2
Q13563	365	439	375	375	Glycosylation	Note=N-linked (GlcNAc...) asparagine;Ontology_term=ECO:0000269,ECO:0000269,ECO:0000269;evidence=ECO:0000269\|PubMed:27768895,ECO:0000269\|PubMed:27991905,ECO:0000269\|PubMed:28092368;Dbxref=PMID:27768895,PMID:27991905,PMID:28092368
Q13563	365	439	399	411	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	365	439	384	384	Natural variant	ID=VAR_064394;Note=In PKD2. A->P;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:21115670;Dbxref=PMID:21115670
Q13563	365	439	414	414	Natural variant	ID=VAR_009195;Note=In PKD2%3B affects channel activity as it is able to abolish channel currents induced by the gain-of-function artificial mutant P-604. W->G;Ontology_term=ECO:0000269,ECO:0000269,ECO:0000269;evidence=ECO:0000269\|PubMed:12707387,ECO:00002
Q13563	365	439	420	420	Natural variant	ID=VAR_058825;Note=In PKD2%3B affects channel activity as it is able to abolish channel currents induced by the gain-of-function artificial mutant P-604. R->G;Ontology_term=ECO:0000269,ECO:0000269;evidence=ECO:0000269\|PubMed:14993477,ECO:0000269\|PubMed:27
Q13563	365	439	242	468	Topological domain	Note=Extracellular;Ontology_term=ECO:0000269,ECO:0000269,ECO:0000269;evidence=ECO:0000269\|PubMed:27768895,ECO:0000269\|PubMed:27991905,ECO:0000269\|PubMed:28092368;Dbxref=PMID:27768895,PMID:27991905,PMID:28092368
Q13563	365	439	364	366	Turn	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	365	439	371	373	Turn	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	365	439	431	434	Turn	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	516	572	484	968	Alternative sequence	ID=VSP_042480;Note=In isoform 2. Missing;Ontology_term=ECO:0000305;evidence=ECO:0000305
Q13563	516	572	517	572	Alternative sequence	ID=VSP_042481;Note=In isoform 3. Missing;Ontology_term=ECO:0000305;evidence=ECO:0000305
Q13563	516	572	1	968	Chain	ID=PRO_0000164356;Note=Polycystin-2
Q13563	516	572	506	527	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	516	572	533	540	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	516	572	549	571	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	516	572	572	579	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	516	572	527	552	Topological domain	Note=Extracellular;Ontology_term=ECO:0000269,ECO:0000269,ECO:0000269;evidence=ECO:0000269\|PubMed:27768895,ECO:0000269\|PubMed:27991905,ECO:0000269\|PubMed:28092368;Dbxref=PMID:27768895,PMID:27991905,PMID:28092368
Q13563	516	572	506	526	Transmembrane	Note=Helical%3B Name%3DS3;Ontology_term=ECO:0000269,ECO:0000269,ECO:0000269;evidence=ECO:0000269\|PubMed:27768895,ECO:0000269\|PubMed:27991905,ECO:0000269\|PubMed:28092368;Dbxref=PMID:27768895,PMID:27991905,PMID:28092368
Q13563	516	572	553	573	Transmembrane	Note=Helical%3B Name%3DS4;Ontology_term=ECO:0000269,ECO:0000269,ECO:0000269;evidence=ECO:0000269\|PubMed:27768895,ECO:0000269\|PubMed:27991905,ECO:0000269\|PubMed:28092368;Dbxref=PMID:27768895,PMID:27991905,PMID:28092368
Q13563	516	572	528	530	Turn	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	673	706	484	968	Alternative sequence	ID=VSP_042480;Note=In isoform 2. Missing;Ontology_term=ECO:0000305;evidence=ECO:0000305
Q13563	673	706	647	968	Alternative sequence	ID=VSP_042483;Note=In isoform 4. Missing;Ontology_term=ECO:0000305;evidence=ECO:0000305
Q13563	673	706	1	968	Chain	ID=PRO_0000164356;Note=Polycystin-2
Q13563	673	706	673	692	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5T4D
Q13563	673	706	684	684	Natural variant	ID=VAR_011076;Note=In PKD2%3B somatic mutation. Missing;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:10835625;Dbxref=PMID:10835625
Q13563	673	706	676	968	Topological domain	Note=Cytoplasmic;Ontology_term=ECO:0000269,ECO:0000269,ECO:0000269;evidence=ECO:0000269\|PubMed:27768895,ECO:0000269\|PubMed:27991905,ECO:0000269\|PubMed:28092368;Dbxref=PMID:27768895,PMID:27991905,PMID:28092368
Q13563	673	706	655	675	Transmembrane	Note=Helical%3B Name%3DS6;Ontology_term=ECO:0000269,ECO:0000269,ECO:0000269;evidence=ECO:0000269\|PubMed:27768895,ECO:0000269\|PubMed:27991905,ECO:0000269\|PubMed:28092368;Dbxref=PMID:27768895,PMID:27991905,PMID:28092368

Top

SNVs in the skipped exons for PKD2

- Lollipop plot for presenting exon skipping associated SNVs.
* Click on the image to enlarge it in a new window.

- Differential PSIs between mutated versus non-mutated samples.

- Non-synonymous mutations located in the skipped exons in TCGA.

Cancer type	Sample	ESID	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
LIHC	TCGA-DD-A1EG-01	exon_skip_424952	88973143	88973310	88973293	88973293	Frame_Shift_Del	T	-	p.F568fs
LIHC	TCGA-DD-A39Y-01	exon_skip_424952	88973143	88973310	88973293	88973293	Frame_Shift_Del	T	-	p.F568fs
LIHC	TCGA-DD-A39Y-01	exon_skip_424953	88979135	88979255	88979226	88979226	Frame_Shift_Del	T	-	p.F664fs
STAD	TCGA-CG-4442-01	exon_skip_424953	88979135	88979255	88979251	88979251	Frame_Shift_Del	T	-	p.L672fs
HNSC	TCGA-CR-5243-01	exon_skip_424952	88973143	88973310	88973183	88973183	Nonsense_Mutation	C	G	p.S530*
COAD	TCGA-CA-5796-01	exon_skip_424960	88989050	88989213	88989098	88989098	Nonsense_Mutation	C	T	p.R803X
SKCM	TCGA-W3-A828-06	exon_skip_424960	88989050	88989213	88989209	88989209	Nonsense_Mutation	C	T	p.Q840*

- Depth of coverage in the three exons composing exon skipping event

Depth of coverage in three exons

Mutation description

- Non-synonymous mutations located in the skipped exons in CCLE.

Sample	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
CORL95_LUNG	88964385	88964609	88964395	88964395	Missense_Mutation	A	T	p.T369S
HEC251_ENDOMETRIUM	88964385	88964609	88964407	88964407	Missense_Mutation	G	T	p.D373Y
EN_ENDOMETRIUM	88964385	88964609	88964590	88964590	Missense_Mutation	A	G	p.N434D
MEWO_SKIN	88967794	88968022	88967810	88967810	Missense_Mutation	C	T	p.P446S
NCIH630_LARGE_INTESTINE	88967794	88968022	88967895	88967895	Missense_Mutation	C	T	p.A474V
BICR18_UPPER_AERODIGESTIVE_TRACT	88967794	88968022	88967927	88967927	Missense_Mutation	T	A	p.F485I
NALM1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	88967794	88968022	88967997	88967997	Missense_Mutation	A	G	p.N508S
DMS53_LUNG	88973143	88973310	88973156	88973156	Missense_Mutation	C	G	p.A521G
KM12_LARGE_INTESTINE	88973143	88973310	88973225	88973225	Missense_Mutation	C	T	p.T544I
SKES1_BONE	88983058	88983156	88983144	88983144	Missense_Mutation	T	A	p.D120E
TFK1_BILIARY_TRACT	88967794	88968022	88967969	88967969	Nonsense_Mutation	A	T	p.K499*
LC1SQSF_LUNG	88964385	88964609	88964607	88967790	Splice_Site	CAGGTGTGTACTGAGGACATGCATCCCTCCTATTTCTGTGTGGTTGTACATACATCCTATTCTGGGGTTAGCCAGAAAAACCTTTGCCTGCAGTTAGCTACATGAGGATGCCAAGGACCCAGACGGATAGCAAGGGAGGGGTAAAAACTGAAGGCTTACCGAAATAAAGGATATTTGAGGAAGGGAGTTGGGATCCTAGAATATTACGAGTTGGAAAGAACCATAACTCTGGTCCAAGTTCATCTCAATGCTGGA	-	p.R440fs
LC1SQSF_LUNG	88967794	88968022	88964607	88967790	Splice_Site	CAGGTGTGTACTGAGGACATGCATCCCTCCTATTTCTGTGTGGTTGTACATACATCCTATTCTGGGGTTAGCCAGAAAAACCTTTGCCTGCAGTTAGCTACATGAGGATGCCAAGGACCCAGACGGATAGCAAGGGAGGGGTAAAAACTGAAGGCTTACCGAAATAAAGGATATTTGAGGAAGGGAGTTGGGATCCTAGAATATTACGAGTTGGAAAGAACCATAACTCTGGTCCAAGTTCATCTCAATGCTGGA	-	p.R440fs
GP2D_LARGE_INTESTINE	88964385	88964609	88964609	88964609	Splice_Site	G	T	p.R440M
GP5D_LARGE_INTESTINE	88964385	88964609	88964609	88964609	Splice_Site	G	T	p.R440M

Top

Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for PKD2

sQTL information located at the skipped exons.

Exon skip ID

Chromosome

Three exons

Skippped exon

ENST

Cancer type

SNP id

Location

DNA change (ref/var)

P-value

Top

Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for PKD2

Top

Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for PKD2

Top

RelatedDrugs for PKD2

Approved drugs targeting this gene.
(DrugBank Version 5.1.0 2018-04-02)

Gene

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

RelatedDiseases for PKD2

Diseases associated with this gene.
(DisGeNet 4.0)

Gene	Disease ID	Disease name	# pubmeds	Source
PKD2	C2751306	Polycystic kidney disease, type 2	6	UNIPROT
PKD2	C0085413	Polycystic Kidney, Autosomal Dominant	4	CTD_human
PKD2	C0023893	Liver Cirrhosis, Experimental	1	CTD_human
PKD2	C0035309	Retinal Diseases	1	CTD_human
PKD2	C0042373	Vascular Diseases	1	CTD_human
PKD2	C0524851	Neurodegenerative Disorders	1	CTD_human

	Gene summary
	Gene structures and expression levels
	Exon skipping events with PSIs in TCGA
	Exon skipping events with PSIs in GTEx
	Open reading frame (ORF) annotation in the exon skipping event
	Exon skipping events in the canonical protein sequence
	SNVs in the skipped exons with depth of coverage
	Splicing Quantitative Trait Loci (sQTLs) in the skipped exons
	Splicing Quantitative Trait Methylation (sQTM) in the skipped exon
	Related drugs with this gene
	Related diseases with this gene

Home

Download

Statistics

Landscape

Help

Contact