|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for PHKA2 |
 Gene summary |
| Gene information | Gene symbol | PHKA2 | Gene ID | 5256 |
| Gene name | phosphorylase kinase regulatory subunit alpha 2 | |
| Synonyms | GSD9A|PHK|PYK|PYKL|XLG|XLG2 | |
| Cytomap | Xp22.13 | |
| Type of gene | protein-coding | |
| Description | phosphorylase b kinase regulatory subunit alpha, liver isoformphosphorylase kinase alpha L subunitphosphorylase kinase alpha-subunitphosphorylase kinase, alpha 2 (liver) | |
| Modification date | 20180523 | |
| UniProtAcc | P46019 | |
| Context | PubMed: PHKA2 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for PHKA2 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for PHKA2 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for PHKA2 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_514154 | X | 18912348:18912522:18913255:18913309:18915280:18915451 | 18913255:18913309 | ENSG00000044446.7 | ENST00000379942.4,ENST00000473739.1,ENST00000469485.1 |
| exon_skip_514168 | X | 18915280:18915451:18917290:18917344:18918787:18918817 | 18917290:18917344 | ENSG00000044446.7 | ENST00000379942.4,ENST00000473739.1 |
| exon_skip_514176 | X | 18917290:18917344:18918787:18918817:18919602:18919721 | 18918787:18918817 | ENSG00000044446.7 | ENST00000379942.4,ENST00000473739.1 |
| exon_skip_514181 | X | 18919602:18919721:18920909:18921028:18923875:18923933 | 18920909:18921028 | ENSG00000044446.7 | ENST00000486231.2 |
| exon_skip_514182 | X | 18919602:18919721:18920935:18921028:18923875:18923933 | 18920935:18921028 | ENSG00000044446.7 | ENST00000469645.1 |
| exon_skip_514183 | X | 18928989:18929078:18936798:18936972:18938149:18938319 | 18936798:18936972 | ENSG00000044446.7 | ENST00000379942.4 |
| exon_skip_514188 | X | 18936813:18936972:18938149:18938319:18942173:18942252 | 18938149:18938319 | ENSG00000044446.7 | ENST00000379942.4 |
| exon_skip_514190 | X | 18942173:18942252:18942498:18942643:18943785:18943895 | 18942498:18942643 | ENSG00000044446.7 | ENST00000379942.4 |
| exon_skip_514193 | X | 18947345:18947424:18949758:18949866:18954172:18954268 | 18949758:18949866 | ENSG00000044446.7 | ENST00000379942.4 |
| exon_skip_514195 | X | 18959646:18959793:18961827:18961926:18963195:18963276 | 18961827:18961926 | ENSG00000044446.7 | ENST00000379942.4 |
| exon_skip_514198 | X | 18961827:18961926:18963195:18963276:18966861:18966944 | 18963195:18963276 | ENSG00000044446.7 | ENST00000379942.4 |
| exon_skip_514199 | X | 18966861:18966944:18969221:18969390:18970611:18970659 | 18969221:18969390 | ENSG00000044446.7 | ENST00000379942.4 |
| exon_skip_514200 | X | 18969221:18969390:18970611:18970659:18972371:18972530 | 18970611:18970659 | ENSG00000044446.7 | ENST00000379942.4 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for PHKA2 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_514154 | X | 18912348:18912522:18913255:18913309:18915280:18915451 | 18913255:18913309 | ENSG00000044446.7 | ENST00000379942.4,ENST00000469485.1,ENST00000473739.1 |
| exon_skip_514168 | X | 18915280:18915451:18917290:18917344:18918787:18918817 | 18917290:18917344 | ENSG00000044446.7 | ENST00000379942.4,ENST00000473739.1 |
| exon_skip_514176 | X | 18917290:18917344:18918787:18918817:18919602:18919721 | 18918787:18918817 | ENSG00000044446.7 | ENST00000379942.4,ENST00000473739.1 |
| exon_skip_514181 | X | 18919602:18919721:18920909:18921028:18923875:18923933 | 18920909:18921028 | ENSG00000044446.7 | ENST00000486231.2 |
| exon_skip_514182 | X | 18919602:18919721:18920935:18921028:18923875:18923933 | 18920935:18921028 | ENSG00000044446.7 | ENST00000469645.1 |
| exon_skip_514183 | X | 18928989:18929078:18936798:18936972:18938149:18938319 | 18936798:18936972 | ENSG00000044446.7 | ENST00000379942.4 |
| exon_skip_514188 | X | 18936813:18936972:18938149:18938319:18942173:18942252 | 18938149:18938319 | ENSG00000044446.7 | ENST00000379942.4 |
| exon_skip_514190 | X | 18942173:18942252:18942498:18942643:18943785:18943895 | 18942498:18942643 | ENSG00000044446.7 | ENST00000379942.4 |
| exon_skip_514193 | X | 18947345:18947424:18949758:18949866:18954172:18954268 | 18949758:18949866 | ENSG00000044446.7 | ENST00000379942.4 |
| exon_skip_514195 | X | 18959646:18959793:18961827:18961926:18963195:18963276 | 18961827:18961926 | ENSG00000044446.7 | ENST00000379942.4 |
| exon_skip_514198 | X | 18961827:18961926:18963195:18963276:18966861:18966944 | 18963195:18963276 | ENSG00000044446.7 | ENST00000379942.4 |
| exon_skip_514199 | X | 18966861:18966944:18969221:18969390:18970611:18970659 | 18969221:18969390 | ENSG00000044446.7 | ENST00000379942.4 |
| exon_skip_514200 | X | 18969221:18969390:18970611:18970659:18972371:18972530 | 18970611:18970659 | ENSG00000044446.7 | ENST00000379942.4 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for PHKA2 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000379942 | 18938149 | 18938319 | Frame-shift |
| ENST00000379942 | 18942498 | 18942643 | Frame-shift |
| ENST00000379942 | 18969221 | 18969390 | Frame-shift |
| ENST00000379942 | 18913255 | 18913309 | In-frame |
| ENST00000379942 | 18917290 | 18917344 | In-frame |
| ENST00000379942 | 18918787 | 18918817 | In-frame |
| ENST00000379942 | 18936798 | 18936972 | In-frame |
| ENST00000379942 | 18949758 | 18949866 | In-frame |
| ENST00000379942 | 18961827 | 18961926 | In-frame |
| ENST00000379942 | 18963195 | 18963276 | In-frame |
| ENST00000379942 | 18970611 | 18970659 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000379942 | 18938149 | 18938319 | Frame-shift |
| ENST00000379942 | 18942498 | 18942643 | Frame-shift |
| ENST00000379942 | 18969221 | 18969390 | Frame-shift |
| ENST00000379942 | 18913255 | 18913309 | In-frame |
| ENST00000379942 | 18917290 | 18917344 | In-frame |
| ENST00000379942 | 18918787 | 18918817 | In-frame |
| ENST00000379942 | 18936798 | 18936972 | In-frame |
| ENST00000379942 | 18949758 | 18949866 | In-frame |
| ENST00000379942 | 18961827 | 18961926 | In-frame |
| ENST00000379942 | 18963195 | 18963276 | In-frame |
| ENST00000379942 | 18970611 | 18970659 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for PHKA2 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000379942 | 5576 | 1235 | 18970611 | 18970659 | 904 | 951 | 79 | 95 |
| ENST00000379942 | 5576 | 1235 | 18963195 | 18963276 | 1204 | 1284 | 179 | 206 |
| ENST00000379942 | 5576 | 1235 | 18961827 | 18961926 | 1285 | 1383 | 206 | 239 |
| ENST00000379942 | 5576 | 1235 | 18949758 | 18949866 | 1804 | 1911 | 379 | 415 |
| ENST00000379942 | 5576 | 1235 | 18936798 | 18936972 | 2630 | 2803 | 654 | 712 |
| ENST00000379942 | 5576 | 1235 | 18918787 | 18918817 | 3694 | 3723 | 1009 | 1019 |
| ENST00000379942 | 5576 | 1235 | 18917290 | 18917344 | 3724 | 3777 | 1019 | 1037 |
| ENST00000379942 | 5576 | 1235 | 18913255 | 18913309 | 3949 | 4002 | 1094 | 1112 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000379942 | 5576 | 1235 | 18970611 | 18970659 | 904 | 951 | 79 | 95 |
| ENST00000379942 | 5576 | 1235 | 18963195 | 18963276 | 1204 | 1284 | 179 | 206 |
| ENST00000379942 | 5576 | 1235 | 18961827 | 18961926 | 1285 | 1383 | 206 | 239 |
| ENST00000379942 | 5576 | 1235 | 18949758 | 18949866 | 1804 | 1911 | 379 | 415 |
| ENST00000379942 | 5576 | 1235 | 18936798 | 18936972 | 2630 | 2803 | 654 | 712 |
| ENST00000379942 | 5576 | 1235 | 18918787 | 18918817 | 3694 | 3723 | 1009 | 1019 |
| ENST00000379942 | 5576 | 1235 | 18917290 | 18917344 | 3724 | 3777 | 1019 | 1037 |
| ENST00000379942 | 5576 | 1235 | 18913255 | 18913309 | 3949 | 4002 | 1094 | 1112 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| P46019 | 79 | 95 | 1 | 1235 | Chain | ID=PRO_0000057730;Note=Phosphorylase b kinase regulatory subunit alpha%2C liver isoform |
| P46019 | 179 | 206 | 1 | 1235 | Chain | ID=PRO_0000057730;Note=Phosphorylase b kinase regulatory subunit alpha%2C liver isoform |
| P46019 | 179 | 206 | 186 | 186 | Natural variant | ID=VAR_006180;Note=In GSD9A%3B type 2. R->C;Ontology_term=ECO:0000269,ECO:0000269;evidence=ECO:0000269|PubMed:10330341,ECO:0000269|PubMed:8733133;Dbxref=dbSNP:rs137852294,PMID:10330341,PMID:8733133 |
| P46019 | 179 | 206 | 186 | 186 | Natural variant | ID=VAR_006181;Note=In GSD9A%3B type 2. R->H;Ontology_term=ECO:0000269,ECO:0000269;evidence=ECO:0000269|PubMed:10330341,ECO:0000269|PubMed:8733134;Dbxref=dbSNP:rs137852290,PMID:10330341,PMID:8733134 |
| P46019 | 179 | 206 | 189 | 190 | Natural variant | ID=VAR_012270;Note=In GSD9A%3B type 2. Missing;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:10330341;Dbxref=PMID:10330341 |
| P46019 | 179 | 206 | 189 | 189 | Natural variant | ID=VAR_012269;Note=In GSD9A%3B type 2. K->E;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:9600238;Dbxref=dbSNP:rs137852295,PMID:9600238 |
| P46019 | 179 | 206 | 193 | 193 | Natural variant | ID=VAR_012271;Note=In GSD9A%3B type 2. G->V;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:7549948;Dbxref=PMID:7549948 |
| P46019 | 206 | 239 | 1 | 1235 | Chain | ID=PRO_0000057730;Note=Phosphorylase b kinase regulatory subunit alpha%2C liver isoform |
| P46019 | 379 | 415 | 1 | 1235 | Chain | ID=PRO_0000057730;Note=Phosphorylase b kinase regulatory subunit alpha%2C liver isoform |
| P46019 | 379 | 415 | 399 | 399 | Natural variant | ID=VAR_012273;Note=In GSD9A%3B type 1. P->S;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:9600238;Dbxref=PMID:9600238 |
| P46019 | 654 | 712 | 1 | 1235 | Chain | ID=PRO_0000057730;Note=Phosphorylase b kinase regulatory subunit alpha%2C liver isoform |
| P46019 | 654 | 712 | 695 | 695 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:23186163;Dbxref=PMID:23186163 |
| P46019 | 1009 | 1019 | 1 | 1235 | Chain | ID=PRO_0000057730;Note=Phosphorylase b kinase regulatory subunit alpha%2C liver isoform |
| P46019 | 1009 | 1019 | 1015 | 1015 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244,ECO:0000244,ECO:0000244,ECO:0000244;evidence=ECO:0000244|PubMed:18669648,ECO:0000244|PubMed:18691976,ECO:0000244|PubMed:19690332,ECO:0000244|PubMed:23186163;Dbxref=PMID:18669648,PMID:18691976,PMID:19690332,PMID |
| P46019 | 1019 | 1037 | 1 | 1235 | Chain | ID=PRO_0000057730;Note=Phosphorylase b kinase regulatory subunit alpha%2C liver isoform |
| P46019 | 1094 | 1112 | 1 | 1235 | Chain | ID=PRO_0000057730;Note=Phosphorylase b kinase regulatory subunit alpha%2C liver isoform |
| P46019 | 1094 | 1112 | 1111 | 1111 | Natural variant | ID=VAR_006184;Note=In GSD9A%3B type 2. R->RTR |
| P46019 | 1094 | 1112 | 1059 | 1099 | Region | Note=Calmodulin-binding;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| P46019 | 79 | 95 | 1 | 1235 | Chain | ID=PRO_0000057730;Note=Phosphorylase b kinase regulatory subunit alpha%2C liver isoform |
| P46019 | 179 | 206 | 1 | 1235 | Chain | ID=PRO_0000057730;Note=Phosphorylase b kinase regulatory subunit alpha%2C liver isoform |
| P46019 | 179 | 206 | 186 | 186 | Natural variant | ID=VAR_006180;Note=In GSD9A%3B type 2. R->C;Ontology_term=ECO:0000269,ECO:0000269;evidence=ECO:0000269|PubMed:10330341,ECO:0000269|PubMed:8733133;Dbxref=dbSNP:rs137852294,PMID:10330341,PMID:8733133 |
| P46019 | 179 | 206 | 186 | 186 | Natural variant | ID=VAR_006181;Note=In GSD9A%3B type 2. R->H;Ontology_term=ECO:0000269,ECO:0000269;evidence=ECO:0000269|PubMed:10330341,ECO:0000269|PubMed:8733134;Dbxref=dbSNP:rs137852290,PMID:10330341,PMID:8733134 |
| P46019 | 179 | 206 | 189 | 190 | Natural variant | ID=VAR_012270;Note=In GSD9A%3B type 2. Missing;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:10330341;Dbxref=PMID:10330341 |
| P46019 | 179 | 206 | 189 | 189 | Natural variant | ID=VAR_012269;Note=In GSD9A%3B type 2. K->E;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:9600238;Dbxref=dbSNP:rs137852295,PMID:9600238 |
| P46019 | 179 | 206 | 193 | 193 | Natural variant | ID=VAR_012271;Note=In GSD9A%3B type 2. G->V;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:7549948;Dbxref=PMID:7549948 |
| P46019 | 206 | 239 | 1 | 1235 | Chain | ID=PRO_0000057730;Note=Phosphorylase b kinase regulatory subunit alpha%2C liver isoform |
| P46019 | 379 | 415 | 1 | 1235 | Chain | ID=PRO_0000057730;Note=Phosphorylase b kinase regulatory subunit alpha%2C liver isoform |
| P46019 | 379 | 415 | 399 | 399 | Natural variant | ID=VAR_012273;Note=In GSD9A%3B type 1. P->S;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:9600238;Dbxref=PMID:9600238 |
| P46019 | 654 | 712 | 1 | 1235 | Chain | ID=PRO_0000057730;Note=Phosphorylase b kinase regulatory subunit alpha%2C liver isoform |
| P46019 | 654 | 712 | 695 | 695 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:23186163;Dbxref=PMID:23186163 |
| P46019 | 1009 | 1019 | 1 | 1235 | Chain | ID=PRO_0000057730;Note=Phosphorylase b kinase regulatory subunit alpha%2C liver isoform |
| P46019 | 1009 | 1019 | 1015 | 1015 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244,ECO:0000244,ECO:0000244,ECO:0000244;evidence=ECO:0000244|PubMed:18669648,ECO:0000244|PubMed:18691976,ECO:0000244|PubMed:19690332,ECO:0000244|PubMed:23186163;Dbxref=PMID:18669648,PMID:18691976,PMID:19690332,PMID |
| P46019 | 1019 | 1037 | 1 | 1235 | Chain | ID=PRO_0000057730;Note=Phosphorylase b kinase regulatory subunit alpha%2C liver isoform |
| P46019 | 1094 | 1112 | 1 | 1235 | Chain | ID=PRO_0000057730;Note=Phosphorylase b kinase regulatory subunit alpha%2C liver isoform |
| P46019 | 1094 | 1112 | 1111 | 1111 | Natural variant | ID=VAR_006184;Note=In GSD9A%3B type 2. R->RTR |
| P46019 | 1094 | 1112 | 1059 | 1099 | Region | Note=Calmodulin-binding;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
Top |
SNVs in the skipped exons for PHKA2 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
PHKA2_BRCA_exon_skip_514195_psi_boxplot.png |
PHKA2_LUAD_exon_skip_514168_psi_boxplot.png |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_514195 | 18961828 | 18961926 | 18961891 | 18961891 | Frame_Shift_Del | A | - | p.F218fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_514195 | 18961828 | 18961926 | 18961891 | 18961891 | Frame_Shift_Del | A | - | p.F218fs |
| OV | TCGA-13-0923-01 | exon_skip_514199 | 18969222 | 18969390 | 18969308 | 18969327 | Frame_Shift_Del | GTGCCACAGGTGGCGGTGTT | - | p.N117fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_514200 | 18970612 | 18970659 | 18970637 | 18970637 | Frame_Shift_Del | C | - | p.G87fs |
| LUAD | TCGA-55-7570-01 | exon_skip_514168 | 18917291 | 18917344 | 18917333 | 18917334 | Frame_Shift_Ins | - | A | p.G1023fs |
| UCEC | TCGA-AP-A0LG-01 | exon_skip_514200 | 18970612 | 18970659 | 18970629 | 18970629 | Nonsense_Mutation | G | A | p.Q90* |
| UCEC | TCGA-AX-A0J1-01 | exon_skip_514200 | 18970612 | 18970659 | 18970641 | 18970641 | Nonsense_Mutation | G | A | p.R86* |
| BRCA | TCGA-BH-A18V-01 | exon_skip_514176 | 18918788 | 18918817 | 18918818 | 18918818 | Splice_Site | C | G | e28-1 |
| BRCA | TCGA-AR-A24Q-01 | exon_skip_514195 | 18961828 | 18961926 | 18961827 | 18961827 | Splice_Site | C | T | e7+1 |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
 | Sample: TCGA-AR-A24Q-01 |
| Cancer type: BRCA | |
| ESID: exon_skip_514195 | |
| Skipped exon start: 18961828 | |
| Skipped exon end: 18961926 | |
| Mutation start: 18961827 | |
| Mutation end: 18961827 | |
| Mutation type: Splice_Site | |
| Reference seq: C | |
| Mutation seq: T | |
| AAchange: e7+1 | |
exon_skip_514195_BRCA_TCGA-AR-A24Q-01.png | |
 | Sample: TCGA-55-7570-01 |
| Cancer type: LUAD | |
| ESID: exon_skip_514168 | |
| Skipped exon start: 18917291 | |
| Skipped exon end: 18917344 | |
| Mutation start: 18917333 | |
| Mutation end: 18917334 | |
| Mutation type: Frame_Shift_Ins | |
| Reference seq: - | |
| Mutation seq: A | |
| AAchange: p.G1023fs | |
exon_skip_45824_LUAD_TCGA-55-7570-01.png | |
exon_skip_45837_LUAD_TCGA-55-7570-01.png | |
exon_skip_514168_LUAD_TCGA-55-7570-01.png | |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| MV411_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 18969222 | 18969390 | 18969282 | 18969283 | Frame_Shift_Del | GG | - | p.H132fs |
| SNUC2B_LARGE_INTESTINE | 18942499 | 18942643 | 18942517 | 18942518 | Frame_Shift_Ins | - | G | p.I566fs |
| SISO_CERVIX | 18913256 | 18913309 | 18913285 | 18913285 | Missense_Mutation | A | T | p.Y1103N |
| GRST_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 18913256 | 18913309 | 18913285 | 18913285 | Missense_Mutation | A | T | p.Y1103N |
| SNU175_LARGE_INTESTINE | 18917291 | 18917344 | 18917310 | 18917310 | Missense_Mutation | G | A | p.A1031V |
| NCIBL2171_MATCHED_NORMAL_TISSUE | 18936799 | 18936972 | 18936843 | 18936843 | Missense_Mutation | T | G | p.D698A |
| SKUT1_SOFT_TISSUE | 18936799 | 18936972 | 18936847 | 18936847 | Missense_Mutation | G | A | p.R697W |
| SEKI_SKIN | 18938150 | 18938319 | 18938181 | 18938181 | Missense_Mutation | C | A | p.L644F |
| JHUEM7_ENDOMETRIUM | 18938150 | 18938319 | 18938238 | 18938238 | Missense_Mutation | C | A | p.E625D |
| HEC1A_ENDOMETRIUM | 18938150 | 18938319 | 18938299 | 18938299 | Missense_Mutation | G | A | p.S605L |
| HEC1_ENDOMETRIUM | 18938150 | 18938319 | 18938299 | 18938299 | Missense_Mutation | G | A | p.S605L |
| HEC1B_ENDOMETRIUM | 18938150 | 18938319 | 18938299 | 18938299 | Missense_Mutation | G | A | p.S605L |
| WSUNHL_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 18942499 | 18942643 | 18942598 | 18942598 | Missense_Mutation | T | C | p.I539V |
| NCIH650_LUNG | 18961828 | 18961926 | 18961847 | 18961847 | Missense_Mutation | T | A | p.D233V |
| HCC44_LUNG | 18961828 | 18961926 | 18961848 | 18961848 | Missense_Mutation | C | G | p.D233H |
| NCIH322_LUNG | 18969222 | 18969390 | 18969224 | 18969224 | Missense_Mutation | G | A | p.S151L |
| FLO1_OESOPHAGUS | 18969222 | 18969390 | 18969228 | 18969228 | Missense_Mutation | C | T | p.A150T |
| CW2_LARGE_INTESTINE | 18969222 | 18969390 | 18969311 | 18969311 | Missense_Mutation | C | T | p.G122D |
| KMBC2_URINARY_TRACT | 18970612 | 18970659 | 18970618 | 18970618 | Missense_Mutation | C | T | p.M93I |
| LN229_CENTRAL_NERVOUS_SYSTEM | 18970612 | 18970659 | 18970638 | 18970638 | Missense_Mutation | C | A | p.G87C |
| JHUEM2_ENDOMETRIUM | 18938150 | 18938319 | 18938177 | 18938177 | Nonsense_Mutation | C | A | p.G646* |
| MELJUSO_SKIN | 18917291 | 18917344 | 18917291 | 18917291 | Splice_Site | C | T | p.A1037A |
| LS411N_LARGE_INTESTINE | 18942499 | 18942643 | 18942499 | 18942499 | Splice_Site | T | C | p.T572A |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for PHKA2 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for PHKA2 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for PHKA2 |
Top |
RelatedDrugs for PHKA2 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for PHKA2 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| PHKA2 | C3694531 | GLYCOGEN STORAGE DISEASE IXa1 | 7 | CTD_human;UNIPROT |
| PHKA2 | C0017919 | Glycogen Storage Disease | 1 | CTD_human |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|