|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for NOP58 |
 Gene summary |
| Gene information | Gene symbol | NOP58 | Gene ID | 51602 |
| Gene name | NOP58 ribonucleoprotein | |
| Synonyms | HSPC120|NOP5|NOP5/NOP58 | |
| Cytomap | 2q33.1 | |
| Type of gene | protein-coding | |
| Description | nucleolar protein 58NOP58 ribonucleoprotein homolognucleolar protein 5nucleolar protein NOP5/NOP58 | |
| Modification date | 20180523 | |
| UniProtAcc | Q9Y2X3 | |
| Context | PubMed: NOP58 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for NOP58 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for NOP58 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for NOP58 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_332512 | 2 | 203130501:203130709:203139835:203139912:203142672:203142725 | 203139835:203139912 | ENSG00000055044.6 | ENST00000472050.1,ENST00000488403.1,ENST00000426814.1 |
| exon_skip_332514 | 2 | 203139884:203139912:203142672:203142725:203147073:203147195 | 203142672:203142725 | ENSG00000055044.6 | ENST00000472050.1,ENST00000264279.5,ENST00000488403.1,ENST00000492688.1 |
| exon_skip_332520 | 2 | 203142674:203142725:203142934:203143052:203147073:203147195 | 203142934:203143052 | ENSG00000055044.6 | ENST00000467734.1,ENST00000426814.1 |
| exon_skip_332521 | 2 | 203142672:203142725:203147073:203147195:203149067:203149101 | 203147073:203147195 | ENSG00000055044.6 | ENST00000264279.5,ENST00000488403.1,ENST00000492688.1 |
| exon_skip_332525 | 2 | 203149160:203149204:203152382:203152447:203155045:203155095 | 203152382:203152447 | ENSG00000055044.6 | ENST00000264279.5,ENST00000433543.2,ENST00000492688.1 |
| exon_skip_332528 | 2 | 203152382:203152447:203155045:203155180:203155847:203155993 | 203155045:203155180 | ENSG00000055044.6 | ENST00000264279.5,ENST00000433543.2 |
| exon_skip_332529 | 2 | 203155847:203155993:203157499:203157626:203160396:203160560 | 203157499:203157626 | ENSG00000055044.6 | ENST00000264279.5 |
| exon_skip_332530 | 2 | 203155847:203155993:203157499:203157626:203162101:203162236 | 203157499:203157626 | ENSG00000055044.6 | ENST00000433543.2 |
| exon_skip_332533 | 2 | 203157499:203157626:203160396:203160560:203162101:203162236 | 203160396:203160560 | ENSG00000055044.6 | ENST00000264279.5 |
| exon_skip_332544 | 2 | 203162567:203162629:203164956:203165090:203167643:203167780 | 203164956:203165090 | ENSG00000055044.6 | ENST00000264279.5 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for NOP58 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_332512 | 2 | 203130501:203130709:203139835:203139912:203142672:203142725 | 203139835:203139912 | ENSG00000055044.6 | ENST00000426814.1,ENST00000488403.1,ENST00000472050.1 |
| exon_skip_332514 | 2 | 203139884:203139912:203142672:203142725:203147073:203147195 | 203142672:203142725 | ENSG00000055044.6 | ENST00000264279.5,ENST00000488403.1,ENST00000472050.1,ENST00000492688.1 |
| exon_skip_332520 | 2 | 203142674:203142725:203142934:203143052:203147073:203147195 | 203142934:203143052 | ENSG00000055044.6 | ENST00000426814.1,ENST00000467734.1 |
| exon_skip_332521 | 2 | 203142672:203142725:203147073:203147195:203149067:203149101 | 203147073:203147195 | ENSG00000055044.6 | ENST00000264279.5,ENST00000488403.1,ENST00000492688.1 |
| exon_skip_332525 | 2 | 203149160:203149204:203152382:203152447:203155045:203155095 | 203152382:203152447 | ENSG00000055044.6 | ENST00000264279.5,ENST00000492688.1,ENST00000433543.2 |
| exon_skip_332528 | 2 | 203152382:203152447:203155045:203155180:203155847:203155993 | 203155045:203155180 | ENSG00000055044.6 | ENST00000264279.5,ENST00000433543.2 |
| exon_skip_332529 | 2 | 203155847:203155993:203157499:203157626:203160396:203160560 | 203157499:203157626 | ENSG00000055044.6 | ENST00000264279.5 |
| exon_skip_332530 | 2 | 203155847:203155993:203157499:203157626:203162101:203162236 | 203157499:203157626 | ENSG00000055044.6 | ENST00000433543.2 |
| exon_skip_332533 | 2 | 203157499:203157626:203160396:203160560:203162101:203162236 | 203160396:203160560 | ENSG00000055044.6 | ENST00000264279.5 |
| exon_skip_332544 | 2 | 203162567:203162629:203164956:203165090:203167643:203167780 | 203164956:203165090 | ENSG00000055044.6 | ENST00000264279.5 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for NOP58 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000264279 | 203142672 | 203142725 | Frame-shift |
| ENST00000264279 | 203147073 | 203147195 | Frame-shift |
| ENST00000264279 | 203152382 | 203152447 | Frame-shift |
| ENST00000264279 | 203157499 | 203157626 | Frame-shift |
| ENST00000264279 | 203160396 | 203160560 | Frame-shift |
| ENST00000264279 | 203164956 | 203165090 | Frame-shift |
| ENST00000264279 | 203155045 | 203155180 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000264279 | 203142672 | 203142725 | Frame-shift |
| ENST00000264279 | 203147073 | 203147195 | Frame-shift |
| ENST00000264279 | 203152382 | 203152447 | Frame-shift |
| ENST00000264279 | 203157499 | 203157626 | Frame-shift |
| ENST00000264279 | 203160396 | 203160560 | Frame-shift |
| ENST00000264279 | 203164956 | 203165090 | Frame-shift |
| ENST00000264279 | 203155045 | 203155180 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for NOP58 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000264279 | 2063 | 529 | 203155045 | 203155180 | 726 | 860 | 166 | 211 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000264279 | 2063 | 529 | 203155045 | 203155180 | 726 | 860 | 166 | 211 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q9Y2X3 | 166 | 211 | 1 | 529 | Chain | ID=PRO_0000219023;Note=Nucleolar protein 58 |
| Q9Y2X3 | 166 | 211 | 202 | 221 | Sequence conflict | Note=LTYCKCLQKVGDRKNYASAK->YHTASVYRKLAIGRLCLCQ;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q9Y2X3 | 166 | 211 | 1 | 529 | Chain | ID=PRO_0000219023;Note=Nucleolar protein 58 |
| Q9Y2X3 | 166 | 211 | 202 | 221 | Sequence conflict | Note=LTYCKCLQKVGDRKNYASAK->YHTASVYRKLAIGRLCLCQ;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
Top |
SNVs in the skipped exons for NOP58 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
NOP58_LIHC_exon_skip_332544_psi_boxplot.png |
NOP58_STAD_exon_skip_332544_psi_boxplot.png |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_332512 | 203139836 | 203139912 | 203139908 | 203139908 | Frame_Shift_Del | A | - | p.K40fs |
| LIHC | TCGA-DD-A1EG-01 | 203157500 | 203157626 | 203157546 | 203157546 | Frame_Shift_Del | A | - | p.Q276fs | |
| LIHC | TCGA-DD-A39Y-01 | 203157500 | 203157626 | 203157546 | 203157546 | Frame_Shift_Del | A | - | p.Q276fs | |
| BLCA | TCGA-XF-AAMG-01 | exon_skip_332533 | 203160397 | 203160560 | 203160445 | 203160464 | Frame_Shift_Del | TTGGAGCTGAAAAGGCACTT | - | p.LGAEKAL319fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_332544 | 203164957 | 203165090 | 203165009 | 203165009 | Frame_Shift_Del | A | - | p.K442fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_332544 | 203164957 | 203165090 | 203165060 | 203165060 | Frame_Shift_Del | A | - | p.K458fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_332544 | 203164957 | 203165090 | 203165066 | 203165066 | Frame_Shift_Del | A | - | p.K461fs |
| STAD | TCGA-F1-6177-01 | exon_skip_332544 | 203164957 | 203165090 | 203165008 | 203165009 | Frame_Shift_Ins | - | A | p.S440fs |
| STAD | TCGA-F1-6177-01 | exon_skip_332544 | 203164957 | 203165090 | 203165009 | 203165010 | Frame_Shift_Ins | - | A | p.S440fs |
| SKCM | TCGA-EE-A2MF-06 | exon_skip_332514 | 203142673 | 203142725 | 203142701 | 203142701 | Nonsense_Mutation | C | T | p.Q51* |
| SKCM | TCGA-EE-A2MF-06 | exon_skip_332514 | 203142673 | 203142725 | 203142701 | 203142701 | Nonsense_Mutation | C | T | p.Q51X |
| UCEC | TCGA-BS-A0UF-01 | 203157500 | 203157626 | 203157506 | 203157506 | Nonsense_Mutation | G | T | p.E263* | |
| COAD | TCGA-G4-6303-01 | 203157500 | 203157626 | 203157515 | 203157515 | Nonsense_Mutation | G | T | p.E266X | |
| STAD | TCGA-D7-A4YV-01 | 203157500 | 203157626 | 203157521 | 203157521 | Nonsense_Mutation | C | T | p.R268* | |
| STAD | TCGA-D7-A4YV-01 | 203157500 | 203157626 | 203157521 | 203157521 | Nonsense_Mutation | C | T | p.R268X | |
| HNSC | TCGA-CR-7368-01 | 203157500 | 203157626 | 203157551 | 203157551 | Nonsense_Mutation | C | T | p.R278* | |
| STAD | TCGA-BR-8360-01 | exon_skip_332512 | 203139836 | 203139912 | 203139835 | 203139835 | Splice_Site | G | T | . |
| UCEC | TCGA-DI-A0WH-01 | 203157500 | 203157626 | 203157628 | 203157628 | Splice_Site | T | C | p.G303_splice |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
 | Sample: TCGA-F1-6177-01 |
| Cancer type: STAD | |
| ESID: exon_skip_332544 | |
| Skipped exon start: 203164957 | |
| Skipped exon end: 203165090 | |
| Mutation start: 203165008 | |
| Mutation end: 203165009 | |
| Mutation type: Frame_Shift_Ins | |
| Reference seq: - | |
| Mutation seq: A | |
| AAchange: p.S440fs | |
| Sample: TCGA-F1-6177-01 |
| Cancer type: STAD | |
| ESID: exon_skip_332544 | |
| Skipped exon start: 203164957 | |
| Skipped exon end: 203165090 | |
| Mutation start: 203165009 | |
| Mutation end: 203165010 | |
| Mutation type: Frame_Shift_Ins | |
| Reference seq: - | |
| Mutation seq: A | |
| AAchange: p.S440fs | |
exon_skip_105325_STAD_TCGA-F1-6177-01.png | |
exon_skip_105326_STAD_TCGA-F1-6177-01.png | |
exon_skip_285856_STAD_TCGA-F1-6177-01.png | |
exon_skip_303345_STAD_TCGA-F1-6177-01.png | |
exon_skip_319572_STAD_TCGA-F1-6177-01.png | |
exon_skip_332544_STAD_TCGA-F1-6177-01.png | |
exon_skip_377238_STAD_TCGA-F1-6177-01.png | |
exon_skip_383047_STAD_TCGA-F1-6177-01.png | |
exon_skip_423141_STAD_TCGA-F1-6177-01.png | |
exon_skip_423142_STAD_TCGA-F1-6177-01.png | |
exon_skip_470537_STAD_TCGA-F1-6177-01.png | |
exon_skip_477308_STAD_TCGA-F1-6177-01.png | |
exon_skip_494000_STAD_TCGA-F1-6177-01.png | |
exon_skip_74586_STAD_TCGA-F1-6177-01.png | |
exon_skip_77151_STAD_TCGA-F1-6177-01.png | |
exon_skip_77155_STAD_TCGA-F1-6177-01.png | |
exon_skip_9828_STAD_TCGA-F1-6177-01.png | |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| SKMEL30_SKIN | 203155046 | 203155180 | 203155078 | 203155084 | Frame_Shift_Del | AACTACA | - | p.NYI178fs |
| HCC1569_BREAST | 203164957 | 203165090 | 203165009 | 203165009 | Frame_Shift_Del | A | - | p.K442fs |
| DG75_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 203164957 | 203165090 | 203165009 | 203165009 | Frame_Shift_Del | A | - | p.K442fs |
| HMC18_BREAST | 203164957 | 203165090 | 203164993 | 203165025 | In_Frame_Del | ACTTCCAACCTGTTCTAAAAAACGCAAAATAGA | - | p.LPTCSKKRKIE436del |
| HEC1_ENDOMETRIUM | 203147074 | 203147195 | 203147093 | 203147093 | Missense_Mutation | G | T | p.E65D |
| SNU349_KIDNEY | 203147074 | 203147195 | 203147115 | 203147115 | Missense_Mutation | A | G | p.K73E |
| SNU1077_ENDOMETRIUM | 203147074 | 203147195 | 203147133 | 203147133 | Missense_Mutation | A | C | p.I79L |
| TT2609C02_THYROID | 203152383 | 203152447 | 203152420 | 203152420 | Missense_Mutation | G | A | p.V158I |
| LNCAPCLONEFGC_PROSTATE | 203152383 | 203152447 | 203152427 | 203152427 | Missense_Mutation | C | A | p.T160K |
| CCK81_LARGE_INTESTINE | 203155046 | 203155180 | 203155081 | 203155081 | Missense_Mutation | T | C | p.Y179H |
| SKGIIIA_CERVIX | 203155046 | 203155180 | 203155163 | 203155163 | Missense_Mutation | A | G | p.K206R |
| L1236_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 203155046 | 203155180 | 203155172 | 203155172 | Missense_Mutation | A | T | p.Q209L |
| HEC59_ENDOMETRIUM | 203157500 | 203157626 | 203157537 | 203157537 | Missense_Mutation | A | G | p.E273G |
| NCIH1155_LUNG | 203157500 | 203157626 | 203157543 | 203157543 | Missense_Mutation | T | C | p.L275P |
| NCIH2081_LUNG | 203160397 | 203160560 | 203160496 | 203160496 | Missense_Mutation | C | T | p.P336L |
| DAUDI_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 203164957 | 203165090 | 203165027 | 203165027 | Missense_Mutation | C | G | p.Q447E |
| CFPAC1_PANCREAS | 203164957 | 203165090 | 203165031 | 203165031 | Missense_Mutation | T | C | p.V448A |
| DAUDI_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 203164957 | 203165090 | 203165084 | 203165084 | Missense_Mutation | G | A | p.V466I |
| SNU81_LARGE_INTESTINE | 203155046 | 203155180 | 203155069 | 203155069 | Nonsense_Mutation | G | T | p.E175* |
| SNU1040_LARGE_INTESTINE | 203155046 | 203155180 | 203155090 | 203155090 | Nonsense_Mutation | C | T | p.R182* |
| JHUEM7_ENDOMETRIUM | 203157500 | 203157626 | 203157551 | 203157551 | Nonsense_Mutation | C | T | p.R278* |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for NOP58 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for NOP58 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for NOP58 |
Top |
RelatedDrugs for NOP58 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for NOP58 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|