|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for LIMA1 |
 Gene summary |
| Gene information | Gene symbol | LIMA1 | Gene ID | 51474 |
| Gene name | LIM domain and actin binding 1 | |
| Synonyms | EPLIN|SREBP3 | |
| Cytomap | 12q13.12 | |
| Type of gene | protein-coding | |
| Description | LIM domain and actin-binding protein 11110021C24Rikepithelial protein lost in neoplasm betasterol regulatory element binding protein 3 | |
| Modification date | 20180522 | |
| UniProtAcc | Q9UHB6 | |
| Context | PubMed: LIMA1 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| LIMA1 | GO:0030835 | negative regulation of actin filament depolymerization | 12566430 |
| LIMA1 | GO:0031529 | ruffle organization | 12566430 |
| LIMA1 | GO:0051017 | actin filament bundle assembly | 12566430 |
Top |
Exon skipping events across known transcript of Ensembl for LIMA1 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for LIMA1 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for LIMA1 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_92089 | 12 | 50575686:50575817:50586234:50586344:50589612:50589670 | 50586234:50586344 | ENSG00000050405.9 | ENST00000552491.1,ENST00000552909.1 |
| exon_skip_92091 | 12 | 50575686:50575820:50579172:50579231:50586234:50586344 | 50579172:50579231 | ENSG00000050405.9 | ENST00000552720.1 |
| exon_skip_92092 | 12 | 50575686:50575820:50586234:50586344:50589612:50589670 | 50586234:50586344 | ENSG00000050405.9 | ENST00000547825.1,ENST00000552823.1,ENST00000341247.4 |
| exon_skip_92093 | 12 | 50575686:50575820:50586234:50586347:50589612:50589670 | 50586234:50586347 | ENSG00000050405.9 | ENST00000552783.1,ENST00000394943.3 |
| exon_skip_92095 | 12 | 50589612:50589670:50594559:50594667:50598334:50598483 | 50594559:50594667 | ENSG00000050405.9 | ENST00000552720.1,ENST00000552909.1,ENST00000552783.1,ENST00000552823.1,ENST00000341247.4,ENST00000394943.3 |
| exon_skip_92099 | 12 | 50594559:50594667:50595085:50595107:50598334:50598483 | 50595085:50595107 | ENSG00000050405.9 | ENST00000552008.1 |
| exon_skip_92101 | 12 | 50594559:50594667:50598334:50598483:50599766:50599851 | 50598334:50598483 | ENSG00000050405.9 | ENST00000552720.1,ENST00000552909.1,ENST00000552783.1,ENST00000552823.1,ENST00000341247.4,ENST00000394943.3 |
| exon_skip_92103 | 12 | 50599766:50599851:50615803:50616268:50625447:50625493 | 50615803:50616268 | ENSG00000050405.9 | ENST00000552720.1,ENST00000341247.4,ENST00000394943.3 |
| exon_skip_92105 | 12 | 50616100:50616268:50625447:50625493:50642415:50642557 | 50625447:50625493 | ENSG00000050405.9 | ENST00000551691.1,ENST00000552720.1,ENST00000550592.1,ENST00000341247.4,ENST00000394943.3 |
| exon_skip_92106 | 12 | 50625447:50625493:50642415:50642557:50677202:50677239 | 50642415:50642557 | ENSG00000050405.9 | ENST00000552720.1,ENST00000341247.4,ENST00000394943.3 |
| exon_skip_92109 | 12 | 50642415:50642557:50643465:50643569:50677202:50677239 | 50643465:50643569 | ENSG00000050405.9 | ENST00000551691.1 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for LIMA1 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_92089 | 12 | 50575686:50575817:50586234:50586344:50589612:50589670 | 50586234:50586344 | ENSG00000050405.9 | ENST00000552491.1,ENST00000552909.1 |
| exon_skip_92091 | 12 | 50575686:50575820:50579172:50579231:50586234:50586344 | 50579172:50579231 | ENSG00000050405.9 | ENST00000552720.1 |
| exon_skip_92092 | 12 | 50575686:50575820:50586234:50586344:50589612:50589670 | 50586234:50586344 | ENSG00000050405.9 | ENST00000547825.1,ENST00000552823.1,ENST00000341247.4 |
| exon_skip_92093 | 12 | 50575686:50575820:50586234:50586347:50589612:50589670 | 50586234:50586347 | ENSG00000050405.9 | ENST00000394943.3,ENST00000552783.1 |
| exon_skip_92095 | 12 | 50589612:50589670:50594559:50594667:50598334:50598483 | 50594559:50594667 | ENSG00000050405.9 | ENST00000552823.1,ENST00000394943.3,ENST00000341247.4,ENST00000552783.1,ENST00000552909.1,ENST00000552720.1 |
| exon_skip_92099 | 12 | 50594559:50594667:50595085:50595107:50598334:50598483 | 50595085:50595107 | ENSG00000050405.9 | ENST00000552008.1 |
| exon_skip_92101 | 12 | 50594559:50594667:50598334:50598483:50599766:50599851 | 50598334:50598483 | ENSG00000050405.9 | ENST00000552823.1,ENST00000394943.3,ENST00000341247.4,ENST00000552783.1,ENST00000552909.1,ENST00000552720.1 |
| exon_skip_92103 | 12 | 50599766:50599851:50615803:50616268:50625447:50625493 | 50615803:50616268 | ENSG00000050405.9 | ENST00000394943.3,ENST00000341247.4,ENST00000552720.1 |
| exon_skip_92105 | 12 | 50616100:50616268:50625447:50625493:50642415:50642557 | 50625447:50625493 | ENSG00000050405.9 | ENST00000394943.3,ENST00000341247.4,ENST00000552720.1,ENST00000551691.1,ENST00000550592.1 |
| exon_skip_92106 | 12 | 50625447:50625493:50642415:50642557:50677202:50677239 | 50642415:50642557 | ENSG00000050405.9 | ENST00000394943.3,ENST00000341247.4,ENST00000552720.1 |
| exon_skip_92109 | 12 | 50642415:50642557:50643465:50643569:50677202:50677239 | 50643465:50643569 | ENSG00000050405.9 | ENST00000551691.1 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for LIMA1 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000341247 | 50642415 | 50642557 | 3UTR-3CDS |
| ENST00000341247 | 50586234 | 50586344 | Frame-shift |
| ENST00000341247 | 50598334 | 50598483 | Frame-shift |
| ENST00000341247 | 50625447 | 50625493 | Frame-shift |
| ENST00000341247 | 50594559 | 50594667 | In-frame |
| ENST00000341247 | 50615803 | 50616268 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000341247 | 50642415 | 50642557 | 3UTR-3CDS |
| ENST00000341247 | 50586234 | 50586344 | Frame-shift |
| ENST00000341247 | 50598334 | 50598483 | Frame-shift |
| ENST00000341247 | 50625447 | 50625493 | Frame-shift |
| ENST00000341247 | 50594559 | 50594667 | In-frame |
| ENST00000341247 | 50615803 | 50616268 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for LIMA1 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000341247 | 3723 | 759 | 50615803 | 50616268 | 316 | 780 | 55 | 210 |
| ENST00000341247 | 3723 | 759 | 50594559 | 50594667 | 1015 | 1122 | 288 | 324 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000341247 | 3723 | 759 | 50615803 | 50616268 | 316 | 780 | 55 | 210 |
| ENST00000341247 | 3723 | 759 | 50594559 | 50594667 | 1015 | 1122 | 288 | 324 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
Top |
SNVs in the skipped exons for LIMA1 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
LIMA1_ESCA_exon_skip_92101_psi_boxplot.png |
LIMA1_LGG_exon_skip_92101_psi_boxplot.png |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_92095 | 50594560 | 50594667 | 50594577 | 50594577 | Frame_Shift_Del | G | - | p.H17fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_92101 | 50598335 | 50598483 | 50598447 | 50598447 | Frame_Shift_Del | T | - | p.N251fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_92101 | 50598335 | 50598483 | 50598461 | 50598461 | Frame_Shift_Del | A | - | p.F246fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_92103 | 50615804 | 50616268 | 50615831 | 50615831 | Frame_Shift_Del | A | - | p.F201fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_92103 | 50615804 | 50616268 | 50615946 | 50615946 | Frame_Shift_Del | T | - | p.N163fs |
| STAD | TCGA-CG-5733-01 | exon_skip_92103 | 50615804 | 50616268 | 50615953 | 50615953 | Frame_Shift_Del | T | - | p.M161fs |
| BLCA | TCGA-E7-A97P-01 | exon_skip_92103 | 50615804 | 50616268 | 50616126 | 50616145 | Frame_Shift_Del | TGGTCTGCTCTGTGCCTAAT | - | p.IRHRADH97fs |
| SKCM | TCGA-EB-A4IS-01 | exon_skip_92103 | 50615804 | 50616268 | 50616159 | 50616159 | Frame_Shift_Del | T | - | p.N92fs |
| LGG | TCGA-FG-7637-01 | exon_skip_92101 | 50598335 | 50598483 | 50598436 | 50598436 | Nonsense_Mutation | G | A | p.R255* |
| ESCA | TCGA-RE-A7BO-01 | exon_skip_92101 | 50598335 | 50598483 | 50598456 | 50598456 | Nonsense_Mutation | G | T | p.S248* |
| ESCA | TCGA-RE-A7BO-01 | exon_skip_92101 | 50598335 | 50598483 | 50598456 | 50598456 | Nonsense_Mutation | G | T | p.S248X |
| THYM | TCGA-XU-A92Q-01 | exon_skip_92103 | 50615804 | 50616268 | 50615899 | 50615899 | Nonsense_Mutation | C | A | p.E179X |
| SKCM | TCGA-EE-A3JB-06 | exon_skip_92103 | 50615804 | 50616268 | 50616039 | 50616039 | Nonsense_Mutation | G | C | p.S132* |
| SKCM | TCGA-EE-A3JB-06 | exon_skip_92103 | 50615804 | 50616268 | 50616039 | 50616039 | Nonsense_Mutation | G | C | p.S132X |
| BLCA | TCGA-DK-A2I4-01 | exon_skip_92103 | 50615804 | 50616268 | 50616148 | 50616148 | Nonsense_Mutation | C | A | p.E96* |
| UCEC | TCGA-BS-A0UF-01 | exon_skip_92106 | 50642416 | 50642557 | 50642471 | 50642471 | Nonsense_Mutation | C | A | p.E22* |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
 | Sample: TCGA-FG-7637-01 |
| Cancer type: LGG | |
| ESID: exon_skip_92101 | |
| Skipped exon start: 50598335 | |
| Skipped exon end: 50598483 | |
| Mutation start: 50598436 | |
| Mutation end: 50598436 | |
| Mutation type: Nonsense_Mutation | |
| Reference seq: G | |
| Mutation seq: A | |
| AAchange: p.R255* | |
exon_skip_92101_LGG_TCGA-FG-7637-01.png | |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| EN_ENDOMETRIUM | 50598335 | 50598483 | 50598447 | 50598447 | Frame_Shift_Del | T | - | p.N251fs |
| KM12_LARGE_INTESTINE | 50615804 | 50616268 | 50615952 | 50615953 | Frame_Shift_Ins | - | T | p.M161fs |
| HCC1195_LUNG | 50586235 | 50586344 | 50586243 | 50586243 | Missense_Mutation | C | G | p.A378P |
| HCC1195_LUNG | 50586235 | 50586347 | 50586243 | 50586243 | Missense_Mutation | C | G | p.A378P |
| HCT15_LARGE_INTESTINE | 50594560 | 50594667 | 50594594 | 50594594 | Missense_Mutation | G | T | p.P313H |
| CAKI2_KIDNEY | 50594560 | 50594667 | 50594643 | 50594643 | Missense_Mutation | C | T | p.E297K |
| ISTMEL1_SKIN | 50594560 | 50594667 | 50594643 | 50594643 | Missense_Mutation | C | T | p.E297K |
| PECAPJ15_UPPER_AERODIGESTIVE_TRACT | 50598335 | 50598483 | 50598443 | 50598443 | Missense_Mutation | C | G | p.E252D |
| LP1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 50615804 | 50616268 | 50615860 | 50615860 | Missense_Mutation | C | T | p.V192I |
| KYAE1_OESOPHAGUS | 50615804 | 50616268 | 50616166 | 50616166 | Missense_Mutation | G | C | p.L90V |
| UMUC5_URINARY_TRACT | 50615804 | 50616268 | 50616178 | 50616178 | Missense_Mutation | G | A | p.H86Y |
| LC1F_LUNG | 50625448 | 50625493 | 50625464 | 50625464 | Missense_Mutation | A | T | p.M50K |
| LC1SQSF_LUNG | 50625448 | 50625493 | 50625464 | 50625464 | Missense_Mutation | A | T | p.M50K |
| LC1SQ_LUNG | 50625448 | 50625493 | 50625464 | 50625464 | Missense_Mutation | A | T | p.M50K |
| HCC2814_LUNG | 50625448 | 50625493 | 50625488 | 50625488 | Missense_Mutation | T | C | p.Q42R |
| NCIH510_LUNG | 50586235 | 50586344 | 50586315 | 50586315 | Nonsense_Mutation | G | A | p.Q354* |
| NCIH510_LUNG | 50586235 | 50586347 | 50586315 | 50586315 | Nonsense_Mutation | G | A | p.Q354* |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for LIMA1 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for LIMA1 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for LIMA1 |
Top |
RelatedDrugs for LIMA1 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for LIMA1 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|