|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for PLCE1 |
 Gene summary |
| Gene information | Gene symbol | PLCE1 | Gene ID | 51196 |
| Gene name | phospholipase C epsilon 1 | |
| Synonyms | NPHS3|PLCE|PPLC | |
| Cytomap | 10q23.33 | |
| Type of gene | protein-coding | |
| Description | 1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase epsilon-1PLC-epsilon-1pancreas-enriched phospholipase Cphosphoinositide phospholipase Cphosphoinositide phospholipase C-epsilon-1phosphoinositide-specific phospholipase C epsilon-1 | |
| Modification date | 20180522 | |
| UniProtAcc | Q9P212 | |
| Context | PubMed: PLCE1 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| PLCE1 | GO:0000187 | activation of MAPK activity | 11022047 |
| PLCE1 | GO:0007200 | phospholipase C-activating G-protein coupled receptor signaling pathway | 11022047|11022048 |
| PLCE1 | GO:0007265 | Ras protein signal transduction | 11022048 |
| PLCE1 | GO:0008277 | regulation of G-protein coupled receptor protein signaling pathway | 11022047 |
| PLCE1 | GO:0045859 | regulation of protein kinase activity | 11022047 |
| PLCE1 | GO:0046578 | regulation of Ras protein signal transduction | 11022047 |
Top |
Exon skipping events across known transcript of Ensembl for PLCE1 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for PLCE1 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for PLCE1 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_43937 | 10 | 95995671:95995877:96005702:96006378:96012072:96012255 | 96005702:96006378 | ENSG00000138193.10 | ENST00000371375.1,ENST00000371385.3,ENST00000371380.3,ENST00000260766.3 |
| exon_skip_43938 | 10 | 96005702:96006378:96012072:96012255:96013946:96014064 | 96012072:96012255 | ENSG00000138193.10 | ENST00000371375.1,ENST00000371385.3,ENST00000371380.3,ENST00000260766.3 |
| exon_skip_43940 | 10 | 96013946:96014064:96014649:96014806:96018556:96018679 | 96014649:96014806 | ENSG00000138193.10 | ENST00000371375.1,ENST00000371385.3,ENST00000371380.3,ENST00000260766.3 |
| exon_skip_43941 | 10 | 96018770:96018907:96022250:96022489:96025403:96025465 | 96022250:96022489 | ENSG00000138193.10 | ENST00000371375.1,ENST00000371385.3,ENST00000371380.3,ENST00000260766.3 |
| exon_skip_43943 | 10 | 96028685:96028793:96030242:96030359:96033318:96033477 | 96030242:96030359 | ENSG00000138193.10 | ENST00000371375.1,ENST00000371385.3,ENST00000371380.3,ENST00000260766.3 |
| exon_skip_43948 | 10 | 96044604:96044722:96053264:96053396:96058135:96058426 | 96053264:96053396 | ENSG00000138193.10 | ENST00000371375.1,ENST00000371385.3,ENST00000371380.3,ENST00000260766.3 |
| exon_skip_43950 | 10 | 96064238:96064402:96066183:96066445:96068337:96068456 | 96066183:96066445 | ENSG00000138193.10 | ENST00000371375.1,ENST00000371385.3,ENST00000371380.3,ENST00000260766.3 |
| exon_skip_43951 | 10 | 96073010:96073139:96076303:96076513:96081657:96081816 | 96076303:96076513 | ENSG00000138193.10 | ENST00000371375.1,ENST00000371385.3,ENST00000371380.3,ENST00000260766.3 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for PLCE1 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_43937 | 10 | 95995671:95995877:96005702:96006378:96012072:96012255 | 96005702:96006378 | ENSG00000138193.10 | ENST00000260766.3,ENST00000371380.3,ENST00000371385.3,ENST00000371375.1 |
| exon_skip_43938 | 10 | 96005702:96006378:96012072:96012255:96013946:96014064 | 96012072:96012255 | ENSG00000138193.10 | ENST00000260766.3,ENST00000371380.3,ENST00000371385.3,ENST00000371375.1 |
| exon_skip_43940 | 10 | 96013946:96014064:96014649:96014806:96018556:96018679 | 96014649:96014806 | ENSG00000138193.10 | ENST00000260766.3,ENST00000371380.3,ENST00000371385.3,ENST00000371375.1 |
| exon_skip_43941 | 10 | 96018770:96018907:96022250:96022489:96025403:96025465 | 96022250:96022489 | ENSG00000138193.10 | ENST00000260766.3,ENST00000371380.3,ENST00000371385.3,ENST00000371375.1 |
| exon_skip_43943 | 10 | 96028685:96028793:96030242:96030359:96033318:96033477 | 96030242:96030359 | ENSG00000138193.10 | ENST00000260766.3,ENST00000371380.3,ENST00000371385.3,ENST00000371375.1 |
| exon_skip_43948 | 10 | 96044604:96044722:96053264:96053396:96058135:96058426 | 96053264:96053396 | ENSG00000138193.10 | ENST00000260766.3,ENST00000371380.3,ENST00000371385.3,ENST00000371375.1 |
| exon_skip_43950 | 10 | 96064238:96064402:96066183:96066445:96068337:96068456 | 96066183:96066445 | ENSG00000138193.10 | ENST00000260766.3,ENST00000371380.3,ENST00000371385.3,ENST00000371375.1 |
| exon_skip_43951 | 10 | 96073010:96073139:96076303:96076513:96081657:96081816 | 96076303:96076513 | ENSG00000138193.10 | ENST00000260766.3,ENST00000371380.3,ENST00000371385.3,ENST00000371375.1 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for PLCE1 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000371380 | 96005702 | 96006378 | Frame-shift |
| ENST00000371380 | 96014649 | 96014806 | Frame-shift |
| ENST00000371380 | 96022250 | 96022489 | Frame-shift |
| ENST00000371380 | 96066183 | 96066445 | Frame-shift |
| ENST00000371380 | 96012072 | 96012255 | In-frame |
| ENST00000371380 | 96030242 | 96030359 | In-frame |
| ENST00000371380 | 96053264 | 96053396 | In-frame |
| ENST00000371380 | 96076303 | 96076513 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000371380 | 96005702 | 96006378 | Frame-shift |
| ENST00000371380 | 96014649 | 96014806 | Frame-shift |
| ENST00000371380 | 96022250 | 96022489 | Frame-shift |
| ENST00000371380 | 96066183 | 96066445 | Frame-shift |
| ENST00000371380 | 96012072 | 96012255 | In-frame |
| ENST00000371380 | 96030242 | 96030359 | In-frame |
| ENST00000371380 | 96053264 | 96053396 | In-frame |
| ENST00000371380 | 96076303 | 96076513 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for PLCE1 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000371380 | 12041 | 2302 | 96012072 | 96012255 | 3332 | 3514 | 1032 | 1093 |
| ENST00000371380 | 12041 | 2302 | 96030242 | 96030359 | 4625 | 4741 | 1463 | 1502 |
| ENST00000371380 | 12041 | 2302 | 96053264 | 96053396 | 5271 | 5402 | 1678 | 1722 |
| ENST00000371380 | 12041 | 2302 | 96076303 | 96076513 | 6368 | 6577 | 2044 | 2114 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000371380 | 12041 | 2302 | 96012072 | 96012255 | 3332 | 3514 | 1032 | 1093 |
| ENST00000371380 | 12041 | 2302 | 96030242 | 96030359 | 4625 | 4741 | 1463 | 1502 |
| ENST00000371380 | 12041 | 2302 | 96053264 | 96053396 | 5271 | 5402 | 1678 | 1722 |
| ENST00000371380 | 12041 | 2302 | 96076303 | 96076513 | 6368 | 6577 | 2044 | 2114 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
Top |
SNVs in the skipped exons for PLCE1 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_43937 | 96005703 | 96006378 | 96005968 | 96005968 | Frame_Shift_Del | C | - | p.P896fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_43937 | 96005703 | 96006378 | 96006268 | 96006268 | Frame_Shift_Del | A | - | p.K996fs |
| BRCA | TCGA-A1-A0SH-01 | exon_skip_43941 | 96022251 | 96022489 | 96022290 | 96022323 | Frame_Shift_Del | TTAAGAGTAAACAGCAGCTATCGGACAACCAGAG | - | p.I1285fs |
| UCEC | TCGA-B5-A0JV-01 | exon_skip_43943 | 96030243 | 96030359 | 96030338 | 96030338 | Frame_Shift_Del | A | - | p.R1495fs |
| LGG | TCGA-HT-8110-01 | exon_skip_43948 | 96053265 | 96053396 | 96053387 | 96053387 | Frame_Shift_Del | T | - | p.S1720fs |
| LGG | TCGA-HT-8110-01 | exon_skip_43948 | 96053265 | 96053396 | 96053387 | 96053387 | Frame_Shift_Del | T | - | p.T1411fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_43950 | 96066184 | 96066445 | 96066228 | 96066228 | Frame_Shift_Del | C | - | p.S1889fs |
| UCEC | TCGA-B5-A11I-01 | exon_skip_43951 | 96076304 | 96076513 | 96076346 | 96076373 | Frame_Shift_Del | TATTTTTTGATGGAAGAAAAATATTTTA | - | p.F2060fs |
| THYM | TCGA-4V-A9QM-01 | exon_skip_43937 | 96005703 | 96006378 | 96005954 | 96005954 | Nonsense_Mutation | T | A | p.L891X |
| HNSC | TCGA-CN-A641-01 | exon_skip_43937 | 96005703 | 96006378 | 96006283 | 96006283 | Nonsense_Mutation | G | T | p.G1001* |
| SARC | TCGA-IS-A3KA-01 | exon_skip_43938 | 96012073 | 96012255 | 96012079 | 96012079 | Nonsense_Mutation | G | T | p.G1035* |
| STAD | TCGA-BR-4368-01 | exon_skip_43940 | 96014650 | 96014806 | 96014707 | 96014707 | Nonsense_Mutation | T | A | p.L1152* |
| UCS | TCGA-ND-A4WC-01 | exon_skip_43943 | 96030243 | 96030359 | 96030304 | 96030304 | Nonsense_Mutation | C | A | p.S1484* |
| UCS | TCGA-ND-A4WC-01 | exon_skip_43943 | 96030243 | 96030359 | 96030304 | 96030304 | Nonsense_Mutation | C | A | p.S1484X |
| BLCA | TCGA-MV-A51V-01 | exon_skip_43943 | 96030243 | 96030359 | 96030322 | 96030322 | Nonsense_Mutation | C | A | p.S1490* |
| UCEC | TCGA-D1-A17Q-01 | exon_skip_43943 | 96030243 | 96030359 | 96030348 | 96030348 | Nonsense_Mutation | G | T | p.E1499* |
| STAD | TCGA-BR-4371-01 | exon_skip_43950 | 96066184 | 96066445 | 96066442 | 96066442 | Nonsense_Mutation | C | T | p.R1961* |
| STAD | TCGA-BR-4371-01 | exon_skip_43950 | 96066184 | 96066445 | 96066442 | 96066442 | Nonsense_Mutation | C | T | p.R1961X |
| THYM | TCGA-4V-A9QM-01 | exon_skip_43950 | 96066184 | 96066445 | 96066442 | 96066442 | Nonsense_Mutation | C | T | p.R1961* |
| THYM | TCGA-4V-A9QM-01 | exon_skip_43950 | 96066184 | 96066445 | 96066442 | 96066442 | Nonsense_Mutation | C | T | p.R1961X |
| UCEC | TCGA-D1-A103-01 | exon_skip_43950 | 96066184 | 96066445 | 96066183 | 96066183 | Splice_Site | G | T | e25-1 |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 96076304 | 96076513 | 96076498 | 96076498 | Frame_Shift_Del | A | - | p.L2109fs |
| EN_ENDOMETRIUM | 96076304 | 96076513 | 96076347 | 96076348 | Frame_Shift_Ins | - | T | p.YF2059fs |
| SQ1_LUNG | 96005703 | 96006378 | 96005809 | 96005809 | Missense_Mutation | A | T | p.T843S |
| F36P_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 96005703 | 96006378 | 96005879 | 96005879 | Missense_Mutation | C | T | p.T866M |
| SNU478_BILIARY_TRACT | 96005703 | 96006378 | 96005879 | 96005879 | Missense_Mutation | C | T | p.T866M |
| SAS_UPPER_AERODIGESTIVE_TRACT | 96005703 | 96006378 | 96005879 | 96005879 | Missense_Mutation | C | T | p.T866M |
| SNU1040_LARGE_INTESTINE | 96005703 | 96006378 | 96006077 | 96006077 | Missense_Mutation | C | T | p.T932M |
| CW2_LARGE_INTESTINE | 96005703 | 96006378 | 96006176 | 96006176 | Missense_Mutation | T | C | p.M965T |
| JHOM1_OVARY | 96005703 | 96006378 | 96006184 | 96006184 | Missense_Mutation | T | A | p.S968T |
| KON_UPPER_AERODIGESTIVE_TRACT | 96005703 | 96006378 | 96006190 | 96006190 | Missense_Mutation | A | G | p.T970A |
| KARPAS45_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 96005703 | 96006378 | 96006280 | 96006280 | Missense_Mutation | A | G | p.S1000G |
| HCT15_LARGE_INTESTINE | 96005703 | 96006378 | 96006365 | 96006365 | Missense_Mutation | T | C | p.V1028A |
| CTB1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 96012073 | 96012255 | 96012146 | 96012146 | Missense_Mutation | G | A | p.R1057Q |
| DG75_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 96012073 | 96012255 | 96012250 | 96012250 | Missense_Mutation | A | G | p.M1092V |
| CORL32_LUNG | 96014650 | 96014806 | 96014692 | 96014692 | Missense_Mutation | G | C | p.R1147T |
| NCIH1915_LUNG | 96022251 | 96022489 | 96022321 | 96022321 | Missense_Mutation | G | T | p.Q1295H |
| SNU1040_LARGE_INTESTINE | 96022251 | 96022489 | 96022353 | 96022353 | Missense_Mutation | G | A | p.S1306N |
| JSC1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 96022251 | 96022489 | 96022389 | 96022389 | Missense_Mutation | C | A | p.S1318Y |
| JHOC5_OVARY | 96022251 | 96022489 | 96022410 | 96022410 | Missense_Mutation | G | C | p.G1325A |
| MM426_SKIN | 96022251 | 96022489 | 96022427 | 96022427 | Missense_Mutation | G | A | p.D1331N |
| JHUEM7_ENDOMETRIUM | 96022251 | 96022489 | 96022427 | 96022427 | Missense_Mutation | G | T | p.D1331Y |
| SUPHD1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 96022251 | 96022489 | 96022475 | 96022475 | Missense_Mutation | C | T | p.L1347F |
| MM127_SKIN | 96030243 | 96030359 | 96030337 | 96030337 | Missense_Mutation | G | A | p.R1495Q |
| COLO783_SKIN | 96030243 | 96030359 | 96030337 | 96030337 | Missense_Mutation | G | A | p.R1495Q |
| BICR18_UPPER_AERODIGESTIVE_TRACT | 96053265 | 96053396 | 96053282 | 96053282 | Missense_Mutation | G | T | p.A1685S |
| SW1463_LARGE_INTESTINE | 96053265 | 96053396 | 96053285 | 96053285 | Missense_Mutation | T | C | p.S1686P |
| HCC2998_LARGE_INTESTINE | 96053265 | 96053396 | 96053329 | 96053329 | Missense_Mutation | T | G | p.I1700M |
| EVSAT_BREAST | 96053265 | 96053396 | 96053355 | 96053355 | Missense_Mutation | G | A | p.S1709N |
| SUDHL5_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 96066184 | 96066445 | 96066247 | 96066247 | Missense_Mutation | G | A | p.V1896I |
| L540_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 96066184 | 96066445 | 96066257 | 96066257 | Missense_Mutation | T | C | p.M1899T |
| RCC10RGB_KIDNEY | 96066184 | 96066445 | 96066281 | 96066281 | Missense_Mutation | G | T | p.R1907L |
| KYSE180_OESOPHAGUS | 96066184 | 96066445 | 96066392 | 96066392 | Missense_Mutation | A | G | p.N1944S |
| MN60_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 96076304 | 96076513 | 96076338 | 96076338 | Missense_Mutation | C | T | p.T2056I |
| MDAMB361_BREAST | 96076304 | 96076513 | 96076343 | 96076343 | Missense_Mutation | G | T | p.D2058Y |
| GP2D_LARGE_INTESTINE | 96076304 | 96076513 | 96076419 | 96076419 | Missense_Mutation | C | T | p.A2083V |
| GP5D_LARGE_INTESTINE | 96076304 | 96076513 | 96076419 | 96076419 | Missense_Mutation | C | T | p.A2083V |
| A375_SKIN | 96076304 | 96076513 | 96076499 | 96076499 | Missense_Mutation | A | G | p.K2110E |
| EVSAT_BREAST | 96076304 | 96076513 | 96076502 | 96076502 | Missense_Mutation | A | C | p.T2111P |
| 647V_URINARY_TRACT | 96022251 | 96022489 | 96022418 | 96022418 | Nonsense_Mutation | C | T | p.Q1328* |
| HEC251_ENDOMETRIUM | 96030243 | 96030359 | 96030322 | 96030322 | Nonsense_Mutation | C | A | p.S1490* |
| HUNS1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 96066184 | 96066445 | 96066298 | 96066298 | Nonsense_Mutation | C | T | p.R1913* |
| SUIT2_PANCREAS | 96012073 | 96012255 | 96012254 | 96012254 | Splice_Site | G | A | p.R1093K |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for PLCE1 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
| exon_skip_43950 | 10 | 96064238:96064402:96066183:96066445:96068337:96068456 | 96066183:96066445 | ENST00000371375.1,ENST00000371385.3,ENST00000371380.3,ENST00000260766.3 | LGG | rs2274223 | chr10:96066341 | A/G | 1.77e-04 |
| exon_skip_43950 | 10 | 96064238:96064402:96066183:96066445:96068337:96068456 | 96066183:96066445 | ENST00000371375.1,ENST00000371385.3,ENST00000371380.3,ENST00000260766.3 | LGG | rs2274223 | chr10:96066341 | A/G | 1.77e-04 |
| exon_skip_43950 | 10 | 96064238:96064402:96066183:96066445:96068337:96068456 | 96066183:96066445 | ENST00000371375.1,ENST00000371385.3,ENST00000371380.3,ENST00000260766.3 | STAD | rs2274223 | chr10:96066341 | A/G | 1.77e-03 |
| exon_skip_43950 | 10 | 96064238:96064402:96066183:96066445:96068337:96068456 | 96066183:96066445 | ENST00000371375.1,ENST00000371385.3,ENST00000371380.3,ENST00000260766.3 | STAD | rs2274223 | chr10:96066341 | A/G | 1.77e-03 |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for PLCE1 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for PLCE1 |
Top |
RelatedDrugs for PLCE1 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for PLCE1 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| PLCE1 | C0279626 | Squamous cell carcinoma of esophagus | 2 | CTD_human |
| PLCE1 | C0001418 | Adenocarcinoma | 1 | CTD_human |
| PLCE1 | C0019100 | Severe Dengue | 1 | CTD_human |
| PLCE1 | C0038356 | Stomach Neoplasms | 1 | CTD_human |
| PLCE1 | C1853124 | NEPHROTIC SYNDROME, TYPE 3 | 1 | CTD_human;UNIPROT |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|