ExonSkipDB: functional annotation of exon skipping event in human

Gene summary for NUMA1

Gene summary

Gene information	Gene symbol	NUMA1
	Gene ID	4926
	Gene name	nuclear mitotic apparatus protein 1
	Synonyms	NMP-22\|NUMA
	Cytomap	11q13.4
	Type of gene	protein-coding
	Description	nuclear mitotic apparatus protein 1SP-H antigencentrophilin stabilizes mitotic spindle in mitotic cellsnuclear matrix protein-22structural nuclear protein
	Modification date	20180523
	UniProtAcc	Q14980
	Context	PubMed: NUMA1 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID)

Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Gene	GO ID	GO term	PubMed ID
NUMA1	GO:0000132	establishment of mitotic spindle orientation	21816348
NUMA1	GO:0030953	astral microtubule organization	12445386
NUMA1	GO:0060236	regulation of mitotic spindle organization	26195665
NUMA1	GO:1902365	positive regulation of protein localization to spindle pole body	16076287

Top

Exon skipping events across known transcript of Ensembl for NUMA1 from UCSC genome browser

Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure.
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Gene isoform structures and expression levels for NUMA1

Expression levels of gene isoforms across TCGA.

Expression levels of gene isoforms across GTEx.

Top

Exon skipping events with PSIs in TCGA for NUMA1

Information of exkip skipping event in TCGA.

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_75213	11	71718399:71718481:71719137:71719191:71719733:71719891	71719137:71719191	ENSG00000137497.13	ENST00000541584.1
exon_skip_75220	11	71720313:71720433:71721831:71721900:71723940:71723972	71721831:71721900	ENSG00000137497.13	ENST00000545721.1,ENST00000358965.6,ENST00000541584.1
exon_skip_75223	11	71721852:71721900:71723446:71723488:71723940:71723972	71723446:71723488	ENSG00000137497.13	ENST00000393695.3
exon_skip_75226	11	71721852:71721900:71723940:71727306:71727453:71727576	71723940:71727306	ENSG00000137497.13	ENST00000358965.6
exon_skip_75228	11	71721852:71721900:71727453:71727576:71728732:71728873	71727453:71727576	ENSG00000137497.13	ENST00000351960.6
exon_skip_75229	11	71723446:71723488:71723940:71727306:71727453:71727576	71723940:71727306	ENSG00000137497.13	ENST00000393695.3
exon_skip_75232	11	71730646:71730663:71732249:71732337:71733384:71733465	71732249:71732337	ENSG00000137497.13	ENST00000393695.3,ENST00000537930.1,ENST00000534987.1,ENST00000540843.1,ENST00000351960.6,ENST00000358965.6,ENST00000543009.1,ENST00000543937.1,ENST00000537217.1,ENST00000544238.1,ENST00000544129.1,ENST00000536119.1,ENST00000542977.1
exon_skip_75234	11	71732271:71732337:71733384:71733465:71734110:71734193	71733384:71733465	ENSG00000137497.13	ENST00000393695.3,ENST00000537930.1,ENST00000534987.1,ENST00000540843.1,ENST00000351960.6,ENST00000358965.6,ENST00000543009.1,ENST00000535947.1,ENST00000543937.1,ENST00000537217.1,ENST00000544238.1,ENST00000544129.1,ENST00000536119.1,ENST00000542977.1
exon_skip_75237	11	71734183:71734193:71735319:71735399:71740250:71740336	71735319:71735399	ENSG00000137497.13	ENST00000541641.1,ENST00000393695.3,ENST00000537930.1,ENST00000368959.5,ENST00000534987.1,ENST00000540843.1,ENST00000541719.1,ENST00000351960.6,ENST00000358965.6,ENST00000543009.1,ENST00000535947.1,ENST00000543937.1,ENST00000537217.1,ENST00000544238.1,ENS
exon_skip_75239	11	71735358:71735399:71740250:71740336:71746947:71747021	71740250:71740336	ENSG00000137497.13	ENST00000541641.1,ENST00000393695.3,ENST00000537930.1,ENST00000368959.5,ENST00000534987.1,ENST00000540843.1,ENST00000541719.1,ENST00000351960.6,ENST00000358965.6,ENST00000543009.1,ENST00000535947.1,ENST00000543937.1,ENST00000546131.1,ENST00000537905.1,ENS
exon_skip_75242	11	71740250:71740336:71746947:71747021:71752004:71752132	71746947:71747021	ENSG00000137497.13	ENST00000536119.1,ENST00000542977.1
exon_skip_75243	11	71740250:71740336:71746947:71747021:71780887:71780957	71746947:71747021	ENSG00000137497.13	ENST00000393695.3,ENST00000540843.1,ENST00000351960.6,ENST00000537905.1,ENST00000537217.1,ENST00000535087.1,ENST00000366394.3
exon_skip_75258	11	71746947:71747021:71760464:71760585:71780887:71780957	71760464:71760585	ENSG00000137497.13	ENST00000541719.1,ENST00000543937.1,ENST00000535838.1
exon_skip_75264	11	71746947:71747021:71761707:71761879:71780887:71780957	71761707:71761879	ENSG00000137497.13	ENST00000541641.1
exon_skip_75267	11	71746947:71747021:71773634:71773732:71780887:71780957	71773634:71773732	ENSG00000137497.13	ENST00000358965.6
exon_skip_75270	11	71746947:71747021:71779124:71779277:71780887:71780957	71779124:71779277	ENSG00000137497.13	ENST00000535111.1
exon_skip_75276	11	71746947:71747021:71779150:71779277:71780887:71780957	71779150:71779277	ENSG00000137497.13	ENST00000534987.1
exon_skip_75278	11	71746947:71747021:71779541:71779663:71780887:71780957	71779541:71779663	ENSG00000137497.13	ENST00000368959.5
exon_skip_75281	11	71746947:71747021:71780887:71780957:71791365:71791435	71780887:71780957	ENSG00000137497.13	ENST00000351960.6,ENST00000537217.1
exon_skip_75282	11	71746947:71747021:71780887:71780957:71791503:71791524	71780887:71780957	ENSG00000137497.13	ENST00000393695.3,ENST00000540843.1,ENST00000537905.1
exon_skip_75303	11	71760464:71760585:71780887:71780957:71791503:71791524	71780887:71780957	ENSG00000137497.13	ENST00000543937.1
exon_skip_75314	11	71780887:71780957:71787613:71787803:71791503:71791524	71787613:71787803	ENSG00000137497.13	ENST00000366394.3

PSI values of skipped exons in TCGA.

Top

Exon skipping events with PSIs in GTEx for NUMA1

Information of exkip skipping event in GTEx

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_75213	11	71718399:71718481:71719137:71719191:71719733:71719891	71719137:71719191	ENSG00000137497.13	ENST00000541584.1
exon_skip_75220	11	71720313:71720433:71721831:71721900:71723940:71723972	71721831:71721900	ENSG00000137497.13	ENST00000541584.1,ENST00000358965.6,ENST00000545721.1
exon_skip_75223	11	71721852:71721900:71723446:71723488:71723940:71723972	71723446:71723488	ENSG00000137497.13	ENST00000393695.3
exon_skip_75226	11	71721852:71721900:71723940:71727306:71727453:71727576	71723940:71727306	ENSG00000137497.13	ENST00000358965.6
exon_skip_75228	11	71721852:71721900:71727453:71727576:71728732:71728873	71727453:71727576	ENSG00000137497.13	ENST00000351960.6
exon_skip_75229	11	71723446:71723488:71723940:71727306:71727453:71727576	71723940:71727306	ENSG00000137497.13	ENST00000393695.3
exon_skip_75232	11	71730646:71730663:71732249:71732337:71733384:71733465	71732249:71732337	ENSG00000137497.13	ENST00000351960.6,ENST00000358965.6,ENST00000393695.3,ENST00000542977.1,ENST00000537217.1,ENST00000534987.1,ENST00000540843.1,ENST00000536119.1,ENST00000544238.1,ENST00000543937.1,ENST00000543009.1,ENST00000537930.1,ENST00000544129.1
exon_skip_75234	11	71732271:71732337:71733384:71733465:71734110:71734193	71733384:71733465	ENSG00000137497.13	ENST00000351960.6,ENST00000358965.6,ENST00000393695.3,ENST00000542977.1,ENST00000537217.1,ENST00000534987.1,ENST00000540843.1,ENST00000536119.1,ENST00000544238.1,ENST00000543937.1,ENST00000543009.1,ENST00000537930.1,ENST00000544129.1,ENST00000535947.1
exon_skip_75237	11	71734183:71734193:71735319:71735399:71740250:71740336	71735319:71735399	ENSG00000137497.13	ENST00000351960.6,ENST00000358965.6,ENST00000393695.3,ENST00000542977.1,ENST00000537217.1,ENST00000534987.1,ENST00000540843.1,ENST00000536119.1,ENST00000544238.1,ENST00000543937.1,ENST00000543009.1,ENST00000537930.1,ENST00000544129.1,ENST00000535947.1,ENS
exon_skip_75239	11	71735358:71735399:71740250:71740336:71746947:71747021	71740250:71740336	ENSG00000137497.13	ENST00000351960.6,ENST00000358965.6,ENST00000393695.3,ENST00000542977.1,ENST00000537217.1,ENST00000534987.1,ENST00000540843.1,ENST00000536119.1,ENST00000544238.1,ENST00000543937.1,ENST00000543009.1,ENST00000537930.1,ENST00000544129.1,ENST00000535947.1,ENS
exon_skip_75242	11	71740250:71740336:71746947:71747021:71752004:71752132	71746947:71747021	ENSG00000137497.13	ENST00000542977.1,ENST00000536119.1
exon_skip_75243	11	71740250:71740336:71746947:71747021:71780887:71780957	71746947:71747021	ENSG00000137497.13	ENST00000351960.6,ENST00000393695.3,ENST00000537217.1,ENST00000540843.1,ENST00000535087.1,ENST00000366394.3,ENST00000537905.1
exon_skip_75258	11	71746947:71747021:71760464:71760585:71780887:71780957	71760464:71760585	ENSG00000137497.13	ENST00000543937.1,ENST00000541719.1,ENST00000535838.1
exon_skip_75264	11	71746947:71747021:71761707:71761879:71780887:71780957	71761707:71761879	ENSG00000137497.13	ENST00000541641.1
exon_skip_75267	11	71746947:71747021:71773634:71773732:71780887:71780957	71773634:71773732	ENSG00000137497.13	ENST00000358965.6
exon_skip_75270	11	71746947:71747021:71779124:71779277:71780887:71780957	71779124:71779277	ENSG00000137497.13	ENST00000535111.1
exon_skip_75276	11	71746947:71747021:71779150:71779277:71780887:71780957	71779150:71779277	ENSG00000137497.13	ENST00000534987.1
exon_skip_75278	11	71746947:71747021:71779541:71779663:71780887:71780957	71779541:71779663	ENSG00000137497.13	ENST00000368959.5
exon_skip_75281	11	71746947:71747021:71780887:71780957:71791365:71791435	71780887:71780957	ENSG00000137497.13	ENST00000351960.6,ENST00000537217.1
exon_skip_75282	11	71746947:71747021:71780887:71780957:71791503:71791524	71780887:71780957	ENSG00000137497.13	ENST00000393695.3,ENST00000540843.1,ENST00000537905.1
exon_skip_75303	11	71760464:71760585:71780887:71780957:71791503:71791524	71780887:71780957	ENSG00000137497.13	ENST00000543937.1
exon_skip_75314	11	71780887:71780957:71787613:71787803:71791503:71791524	71787613:71787803	ENSG00000137497.13	ENST00000366394.3

PSI values of skipped exons in GTEx.

* Skipped exon sequences.

Top

Open reading frame (ORF) annotation in the exon skipping event for NUMA1

Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms.

ENST	Start of skipped exon	End of skipped exon	ORF
ENST00000393695	71746947	71747021	3UTR-3CDS
ENST00000393695	71780887	71780957	3UTR-3UTR
ENST00000393695	71732249	71732337	Frame-shift
ENST00000393695	71735319	71735399	Frame-shift
ENST00000393695	71740250	71740336	Frame-shift
ENST00000393695	71723446	71723488	In-frame
ENST00000393695	71723940	71727306	In-frame
ENST00000393695	71733384	71733465	In-frame

Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms.

ENST	Start of skipped exon	End of skipped exon	ORF
ENST00000393695	71746947	71747021	3UTR-3CDS
ENST00000393695	71780887	71780957	3UTR-3UTR
ENST00000393695	71732249	71732337	Frame-shift
ENST00000393695	71735319	71735399	Frame-shift
ENST00000393695	71740250	71740336	Frame-shift
ENST00000393695	71723446	71723488	In-frame
ENST00000393695	71723940	71727306	In-frame
ENST00000393695	71733384	71733465	In-frame

Top

Infer the effects of exon skipping event on protein functional features for NUMA1

Exon skipping at the protein sequence level and followed lost functional features.
* Click on the image to enlarge it in a new window.

Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases.

ENST	Length of mRNA	Length of AA seq.	Genomic start	Genomic end	mRNA start	mRNA end	AA start	AA end
ENST00000393695	7360	2115	71733384	71733465	624	704	97	124
ENST00000393695	7360	2115	71723940	71727306	1575	4940	414	1536
ENST00000393695	7360	2115	71723446	71723488	4941	4982	1536	1550

Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases.

ENST	Length of mRNA	Length of AA seq.	Genomic start	Genomic end	mRNA start	mRNA end	AA start	AA end
ENST00000393695	7360	2115	71733384	71733465	624	704	97	124
ENST00000393695	7360	2115	71723940	71727306	1575	4940	414	1536
ENST00000393695	7360	2115	71723446	71723488	4941	4982	1536	1550

Lost protein functional features of individual exon skipping events in TCGA.

UniProt acc.	Start of exon skipping (AA)	End of exon skipping (AA)	Protein feature start (AA)	Protein feature end (AA)	Category of protein feature	Description of feature
Q14980	97	124	1	2115	Chain	ID=PRO_0000057998;Note=Nuclear mitotic apparatus protein 1
Q14980	97	124	1	212	Region	Note=Head (Globular)
Q14980	414	1536	414	1549	Alternative sequence	ID=VSP_054146;Note=In isoform 5. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:15489334;Dbxref=PMID:15489334
Q14980	414	1536	1536	1549	Alternative sequence	ID=VSP_012910;Note=In isoform 2. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:1541636;Dbxref=PMID:1541636
Q14980	414	1536	1	2115	Chain	ID=PRO_0000057998;Note=Nuclear mitotic apparatus protein 1
Q14980	414	1536	213	1699	Coiled coil	Ontology_term=ECO:0000255;evidence=ECO:0000255
Q14980	414	1536	820	820	Modified residue	Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244\|PubMed:17525332;Dbxref=PMID:17525332
Q14980	414	1536	891	891	Modified residue	Note=N6-acetyllysine;Ontology_term=ECO:0000244;evidence=ECO:0000244\|PubMed:19608861;Dbxref=PMID:19608861
Q14980	414	1536	1047	1047	Modified residue	Note=Phosphothreonine%3B by PLK1;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:22327364;Dbxref=PMID:22327364
Q14980	414	1536	1187	1187	Modified residue	Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244\|PubMed:20068231;Dbxref=PMID:20068231
Q14980	414	1536	1225	1225	Modified residue	Note=Phosphoserine;Ontology_term=ECO:0000244,ECO:0000244,ECO:0000244;evidence=ECO:0000244\|PubMed:19690332,ECO:0000244\|PubMed:20068231,ECO:0000244\|PubMed:24275569;Dbxref=PMID:19690332,PMID:20068231,PMID:24275569
Q14980	414	1536	1511	1511	Modified residue	Note=N6-acetyllysine;Ontology_term=ECO:0000244;evidence=ECO:0000244\|PubMed:19608861;Dbxref=PMID:19608861
Q14980	414	1536	794	794	Natural variant	ID=VAR_031680;Note=A->G;Dbxref=dbSNP:rs3750913
Q14980	414	1536	1153	1153	Natural variant	ID=VAR_031681;Note=E->D;Dbxref=dbSNP:rs34311364
Q14980	414	1536	772	772	Sequence conflict	Note=Q->L;Ontology_term=ECO:0000305;evidence=ECO:0000305
Q14980	414	1536	815	816	Sequence conflict	Note=ER->DG;Ontology_term=ECO:0000305;evidence=ECO:0000305
Q14980	414	1536	873	873	Sequence conflict	Note=E->K;Ontology_term=ECO:0000305;evidence=ECO:0000305
Q14980	1536	1550	414	1549	Alternative sequence	ID=VSP_054146;Note=In isoform 5. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:15489334;Dbxref=PMID:15489334
Q14980	1536	1550	1536	1549	Alternative sequence	ID=VSP_012910;Note=In isoform 2. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:1541636;Dbxref=PMID:1541636
Q14980	1536	1550	1	2115	Chain	ID=PRO_0000057998;Note=Nuclear mitotic apparatus protein 1
Q14980	1536	1550	213	1699	Coiled coil	Ontology_term=ECO:0000255;evidence=ECO:0000255

Lost protein functional features of individual exon skipping events in GTEx.

UniProt acc.	Start of exon skipping (AA)	End of exon skipping (AA)	Protein feature start (AA)	Protein feature end (AA)	Category of protein feature	Description of feature
Q14980	97	124	1	2115	Chain	ID=PRO_0000057998;Note=Nuclear mitotic apparatus protein 1
Q14980	97	124	1	212	Region	Note=Head (Globular)
Q14980	414	1536	414	1549	Alternative sequence	ID=VSP_054146;Note=In isoform 5. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:15489334;Dbxref=PMID:15489334
Q14980	414	1536	1536	1549	Alternative sequence	ID=VSP_012910;Note=In isoform 2. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:1541636;Dbxref=PMID:1541636
Q14980	414	1536	1	2115	Chain	ID=PRO_0000057998;Note=Nuclear mitotic apparatus protein 1
Q14980	414	1536	213	1699	Coiled coil	Ontology_term=ECO:0000255;evidence=ECO:0000255
Q14980	414	1536	820	820	Modified residue	Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244\|PubMed:17525332;Dbxref=PMID:17525332
Q14980	414	1536	891	891	Modified residue	Note=N6-acetyllysine;Ontology_term=ECO:0000244;evidence=ECO:0000244\|PubMed:19608861;Dbxref=PMID:19608861
Q14980	414	1536	1047	1047	Modified residue	Note=Phosphothreonine%3B by PLK1;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:22327364;Dbxref=PMID:22327364
Q14980	414	1536	1187	1187	Modified residue	Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244\|PubMed:20068231;Dbxref=PMID:20068231
Q14980	414	1536	1225	1225	Modified residue	Note=Phosphoserine;Ontology_term=ECO:0000244,ECO:0000244,ECO:0000244;evidence=ECO:0000244\|PubMed:19690332,ECO:0000244\|PubMed:20068231,ECO:0000244\|PubMed:24275569;Dbxref=PMID:19690332,PMID:20068231,PMID:24275569
Q14980	414	1536	1511	1511	Modified residue	Note=N6-acetyllysine;Ontology_term=ECO:0000244;evidence=ECO:0000244\|PubMed:19608861;Dbxref=PMID:19608861
Q14980	414	1536	794	794	Natural variant	ID=VAR_031680;Note=A->G;Dbxref=dbSNP:rs3750913
Q14980	414	1536	1153	1153	Natural variant	ID=VAR_031681;Note=E->D;Dbxref=dbSNP:rs34311364
Q14980	414	1536	772	772	Sequence conflict	Note=Q->L;Ontology_term=ECO:0000305;evidence=ECO:0000305
Q14980	414	1536	815	816	Sequence conflict	Note=ER->DG;Ontology_term=ECO:0000305;evidence=ECO:0000305
Q14980	414	1536	873	873	Sequence conflict	Note=E->K;Ontology_term=ECO:0000305;evidence=ECO:0000305
Q14980	1536	1550	414	1549	Alternative sequence	ID=VSP_054146;Note=In isoform 5. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:15489334;Dbxref=PMID:15489334
Q14980	1536	1550	1536	1549	Alternative sequence	ID=VSP_012910;Note=In isoform 2. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:1541636;Dbxref=PMID:1541636
Q14980	1536	1550	1	2115	Chain	ID=PRO_0000057998;Note=Nuclear mitotic apparatus protein 1
Q14980	1536	1550	213	1699	Coiled coil	Ontology_term=ECO:0000255;evidence=ECO:0000255

Top

SNVs in the skipped exons for NUMA1

- Lollipop plot for presenting exon skipping associated SNVs.
* Click on the image to enlarge it in a new window.

- Differential PSIs between mutated versus non-mutated samples.

NUMA1_LIHC_exon_skip_75223_psi_boxplot.png
boxplot

- Non-synonymous mutations located in the skipped exons in TCGA.

Cancer type	Sample	ESID	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
LIHC	TCGA-G3-A3CK-01	exon_skip_75223	71723447	71723488	71723462	71723628	Frame_Shift_Del	TCTCTGAAATACCTCTAGCTGCTCCACCTGTACATGGGGGAGGAGCAACAGAGACAGAGTGAGATGAGGCCAAAGAAGCACCAGCCCTGCTGCCAGGCTGACCTCACTGAGGCTCTGATACTTTCCCCTAAGGAGCTAGATTGACAGTAAGTTTAAAAATGCCAGTT	-	p.1537_1546del
LIHC	TCGA-G3-A3CJ-01	exon_skip_75229 exon_skip_75226	71723941	71727306	71724008	71724008	Frame_Shift_Del	C	-	p.G1514fs
STAD	TCGA-BR-6802-01	exon_skip_75229 exon_skip_75226	71723941	71727306	71724190	71724190	Frame_Shift_Del	C	-	p.L1454fs
LIHC	TCGA-DD-A3A0-01	exon_skip_75229 exon_skip_75226	71723941	71727306	71725170	71725170	Frame_Shift_Del	C	-	p.A1127fs
LUAD	TCGA-93-A4JN-01	exon_skip_75229 exon_skip_75226	71723941	71727306	71725333	71725339	Frame_Shift_Del	CAGACCA	-	p.RGL1070fs
LIHC	TCGA-G3-A3CJ-01	exon_skip_75229 exon_skip_75226	71723941	71727306	71725383	71725383	Frame_Shift_Del	G	-	p.L1056fs
LUAD	TCGA-50-6590-01	exon_skip_75229 exon_skip_75226	71723941	71727306	71725417	71725418	Frame_Shift_Del	CT	-	p.E1044fs
LIHC	TCGA-DD-A39Y-01	exon_skip_75229 exon_skip_75226	71723941	71727306	71726125	71726125	Frame_Shift_Del	T	-	p.K808fs
LIHC	TCGA-DD-A116-01	exon_skip_75229 exon_skip_75226	71723941	71727306	71726211	71726220	Frame_Shift_Del	CCTGATGGGC	-	p.777_780del
LIHC	TCGA-DD-A116-01	exon_skip_75229 exon_skip_75226	71723941	71727306	71726211	71726220	Frame_Shift_Del	CCTGATGGGC	-	p.AHQA777fs
LIHC	TCGA-DD-A3A0-01	exon_skip_75229 exon_skip_75226	71723941	71727306	71726244	71726244	Frame_Shift_Del	C	-	p.A769fs
LIHC	TCGA-DD-A3A0-01	exon_skip_75229 exon_skip_75226	71723941	71727306	71726491	71726491	Frame_Shift_Del	T	-	p.K686fs
STAD	TCGA-F1-A448-01	exon_skip_75229 exon_skip_75226	71723941	71727306	71726491	71726491	Frame_Shift_Del	T	-	p.A687fs
LIHC	TCGA-DD-A39Y-01	exon_skip_75229 exon_skip_75226	71723941	71727306	71727069	71727069	Frame_Shift_Del	C	-	p.A494fs
HNSC	TCGA-CV-7101-01	exon_skip_75229 exon_skip_75226	71723941	71727306	71727303	71727306	Frame_Shift_Del	CCAG	-	p.L415fs
KIRP	TCGA-GL-A59T-01	exon_skip_75234	71733385	71733465	71733436	71733436	Frame_Shift_Del	G	-	p.M108X
KIRP	TCGA-GL-A59T-01	exon_skip_75234	71733385	71733465	71733436	71733436	Frame_Shift_Del	G	-	p.T107fs
STAD	TCGA-BR-8360-01	exon_skip_75242 exon_skip_75243	71746948	71747021	71746965	71746965	Frame_Shift_Del	C	-	p.A9fs
STAD	TCGA-D7-A6EY-01	exon_skip_75242 exon_skip_75243	71746948	71747021	71746965	71746965	Frame_Shift_Del	C	-	p.A10fs
UCEC	TCGA-D1-A0ZS-01	exon_skip_75242 exon_skip_75243	71746948	71747021	71746965	71746965	Frame_Shift_Del	C	-	p.A9fs
ESCA	TCGA-LN-A4MQ-01	exon_skip_75229 exon_skip_75226	71723941	71727306	71726383	71726384	Frame_Shift_Ins	-	T	p.K722fs
ESCA	TCGA-LN-A4MQ-01	exon_skip_75229 exon_skip_75226	71723941	71727306	71726383	71726384	Frame_Shift_Ins	-	T	p.R723fs
ESCA	TCGA-LN-A4MQ-01	exon_skip_75229 exon_skip_75226	71723941	71727306	71726383	71726384	Frame_Shift_Ins	-	T	p.T722fs
KIRC	TCGA-A3-3319-01	exon_skip_75242 exon_skip_75243	71746948	71747021	71746964	71746965	Frame_Shift_Ins	-	C	p.C9fs
UCEC	TCGA-A5-A0GB-01	exon_skip_75242 exon_skip_75243	71746948	71747021	71746964	71746965	Frame_Shift_Ins	-	C	p.A9fs
HNSC	TCGA-IQ-7630-01	exon_skip_75220	71721832	71721900	71721849	71721849	Nonsense_Mutation	G	A	p.Q1568*
SKCM	TCGA-EE-A2GC-06	exon_skip_75220	71721832	71721900	71721864	71721864	Nonsense_Mutation	G	A	p.Q1563*
SKCM	TCGA-EE-A2GC-06	exon_skip_75220	71721832	71721900	71721864	71721864	Nonsense_Mutation	G	A	p.Q1563X
LUSC	TCGA-18-3406-01	exon_skip_75229 exon_skip_75226	71723941	71727306	71724063	71724063	Nonsense_Mutation	G	A	p.R1496*
STAD	TCGA-BR-6706-01	exon_skip_75229 exon_skip_75226	71723941	71727306	71724063	71724063	Nonsense_Mutation	G	A	p.R1496*
UCEC	TCGA-B5-A0JZ-01	exon_skip_75229 exon_skip_75226	71723941	71727306	71724510	71724510	Nonsense_Mutation	G	A	p.Q1347*
HNSC	TCGA-CR-6477-01	exon_skip_75229 exon_skip_75226	71723941	71727306	71725761	71725761	Nonsense_Mutation	G	A	p.Q930*
LUAD	TCGA-62-A471-01	exon_skip_75229 exon_skip_75226	71723941	71727306	71726241	71726241	Nonsense_Mutation	G	A	p.R770*
LUAD	TCGA-44-7667-01	exon_skip_75229 exon_skip_75226	71723941	71727306	71726319	71726319	Nonsense_Mutation	G	A	p.R744*
SKCM	TCGA-EE-A2MR-06	exon_skip_75229 exon_skip_75226	71723941	71727306	71726466	71726466	Nonsense_Mutation	G	A	p.Q695*
BRCA	TCGA-D8-A27P-01	exon_skip_75229 exon_skip_75226	71723941	71727306	71726685	71726685	Nonsense_Mutation	G	A	p.Q622*

- Depth of coverage in the three exons composing exon skipping event

Depth of coverage in three exons	Mutation description
	Sample: TCGA-D8-A27P-01
	Cancer type: BRCA
	ESID: exon_skip_75226
	Skipped exon start: 71723941
	Skipped exon end: 71727306
	Mutation start: 71726685
	Mutation end: 71726685
	Mutation type: Nonsense_Mutation
	Reference seq: G
	Mutation seq: A
	AAchange: p.Q622*
exon_skip_75226_BRCA_TCGA-D8-A27P-01.png
exon_skip_75229_BRCA_TCGA-D8-A27P-01.png
	Sample: TCGA-LN-A4MQ-01
	Cancer type: ESCA
	ESID: exon_skip_75226
	Skipped exon start: 71723941
	Skipped exon end: 71727306
	Mutation start: 71726383
	Mutation end: 71726384
	Mutation type: Frame_Shift_Ins
	Reference seq: -
	Mutation seq: T
	AAchange: p.K722fs
	Sample: TCGA-LN-A4MQ-01
	Cancer type: ESCA
	ESID: exon_skip_75226
	Skipped exon start: 71723941
	Skipped exon end: 71727306
	Mutation start: 71726383
	Mutation end: 71726384
	Mutation type: Frame_Shift_Ins
	Reference seq: -
	Mutation seq: T
	AAchange: p.T722fs
	Sample: TCGA-LN-A4MQ-01
	Cancer type: ESCA
	ESID: exon_skip_75226
	Skipped exon start: 71723941
	Skipped exon end: 71727306
	Mutation start: 71726383
	Mutation end: 71726384
	Mutation type: Frame_Shift_Ins
	Reference seq: -
	Mutation seq: T
	AAchange: p.R723fs
exon_skip_75226_ESCA_TCGA-LN-A4MQ-01.png
exon_skip_75229_ESCA_TCGA-LN-A4MQ-01.png
	Sample: TCGA-F1-A448-01
	Cancer type: STAD
	ESID: exon_skip_75226
	Skipped exon start: 71723941
	Skipped exon end: 71727306
	Mutation start: 71726491
	Mutation end: 71726491
	Mutation type: Frame_Shift_Del
	Reference seq: T
	Mutation seq: -
	AAchange: p.A687fs
exon_skip_27769_STAD_TCGA-F1-A448-01.png
exon_skip_34054_STAD_TCGA-F1-A448-01.png
exon_skip_378855_STAD_TCGA-F1-A448-01.png
exon_skip_75226_STAD_TCGA-F1-A448-01.png
	Sample: TCGA-BR-6802-01
	Cancer type: STAD
	ESID: exon_skip_75226
	Skipped exon start: 71723941
	Skipped exon end: 71727306
	Mutation start: 71724190
	Mutation end: 71724190
	Mutation type: Frame_Shift_Del
	Reference seq: C
	Mutation seq: -
	AAchange: p.L1454fs
exon_skip_137953_STAD_TCGA-BR-6802-01.png
exon_skip_137954_STAD_TCGA-BR-6802-01.png
exon_skip_75226_STAD_TCGA-BR-6802-01.png
	Sample: TCGA-D8-A27P-01
	Cancer type: BRCA
	ESID: exon_skip_75226
	Skipped exon start: 71723941
	Skipped exon end: 71727306
	Mutation start: 71726685
	Mutation end: 71726685
	Mutation type: Nonsense_Mutation
	Reference seq: G
	Mutation seq: A
	AAchange: p.Q622*
exon_skip_75226_BRCA_TCGA-D8-A27P-01.png
exon_skip_75229_BRCA_TCGA-D8-A27P-01.png
	Sample: TCGA-LN-A4MQ-01
	Cancer type: ESCA
	ESID: exon_skip_75226
	Skipped exon start: 71723941
	Skipped exon end: 71727306
	Mutation start: 71726383
	Mutation end: 71726384
	Mutation type: Frame_Shift_Ins
	Reference seq: -
	Mutation seq: T
	AAchange: p.K722fs
	Sample: TCGA-LN-A4MQ-01
	Cancer type: ESCA
	ESID: exon_skip_75226
	Skipped exon start: 71723941
	Skipped exon end: 71727306
	Mutation start: 71726383
	Mutation end: 71726384
	Mutation type: Frame_Shift_Ins
	Reference seq: -
	Mutation seq: T
	AAchange: p.T722fs
	Sample: TCGA-LN-A4MQ-01
	Cancer type: ESCA
	ESID: exon_skip_75226
	Skipped exon start: 71723941
	Skipped exon end: 71727306
	Mutation start: 71726383
	Mutation end: 71726384
	Mutation type: Frame_Shift_Ins
	Reference seq: -
	Mutation seq: T
	AAchange: p.R723fs
exon_skip_75226_ESCA_TCGA-LN-A4MQ-01.png
exon_skip_75229_ESCA_TCGA-LN-A4MQ-01.png
	Sample: TCGA-F1-A448-01
	Cancer type: STAD
	ESID: exon_skip_75226
	Skipped exon start: 71723941
	Skipped exon end: 71727306
	Mutation start: 71726491
	Mutation end: 71726491
	Mutation type: Frame_Shift_Del
	Reference seq: T
	Mutation seq: -
	AAchange: p.A687fs
exon_skip_27769_STAD_TCGA-F1-A448-01.png
exon_skip_34054_STAD_TCGA-F1-A448-01.png
exon_skip_378855_STAD_TCGA-F1-A448-01.png
exon_skip_75226_STAD_TCGA-F1-A448-01.png
	Sample: TCGA-BR-6802-01
	Cancer type: STAD
	ESID: exon_skip_75226
	Skipped exon start: 71723941
	Skipped exon end: 71727306
	Mutation start: 71724190
	Mutation end: 71724190
	Mutation type: Frame_Shift_Del
	Reference seq: C
	Mutation seq: -
	AAchange: p.L1454fs
exon_skip_137953_STAD_TCGA-BR-6802-01.png
exon_skip_137954_STAD_TCGA-BR-6802-01.png
exon_skip_75226_STAD_TCGA-BR-6802-01.png
	Sample: TCGA-G3-A3CK-01
	Cancer type: LIHC
	ESID: exon_skip_75223
	Skipped exon start: 71723447
	Skipped exon end: 71723488
	Mutation start: 71723462
	Mutation end: 71723628
	Mutation type: Frame_Shift_Del
	Reference seq: TCTCTGAAATACCTCTAGCTGCTCCACCTGTACATGGGGGAGGAGCAACAGAGACAGAGTGAGATGAGGCCAAAGAAGCACCAGCCCTGCTGCCAGGCTGACCTCACTGAGGCTCTGATACTTTCCCCTAAGGAGCTAGATTGACAGTAAGTTTAAAAATGCCAGTT
	Mutation seq: -
	AAchange: p.1537_1546del
exon_skip_285060_LIHC_TCGA-G3-A3CK-01.png
exon_skip_75223_LIHC_TCGA-G3-A3CK-01.png

- Non-synonymous mutations located in the skipped exons in CCLE.

Sample	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
CAL148_BREAST	71723941	71727306	71724367	71724367	Frame_Shift_Del	T	-	p.G1394fs
HCC2450_LUNG	71723941	71727306	71726690	71726691	Frame_Shift_Del	AG	-	p.L620fs
ZR7530_BREAST	71727454	71727576	71727573	71727573	Frame_Shift_Del	A	-	p.C375fs
SNU520_STOMACH	71746948	71747021	71746965	71746965	Frame_Shift_Del	C	-	p.A10fs
ISHIKAWAHERAKLIO02ER_ENDOMETRIUM	71746948	71747021	71746965	71746965	Frame_Shift_Del	C	-	p.A10fs
SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	71746948	71747021	71746965	71746965	Frame_Shift_Del	C	-	p.A10fs
769P_KIDNEY	71723941	71727306	71724001	71724015	In_Frame_Del	CTTGGCACCCTCATA	-	p.YEGAK1512del
PACADD137_PANCREAS	71723941	71727306	71727169	71727171	In_Frame_Del	TTC	-	p.E460del
NB17_AUTONOMIC_GANGLIA	71723941	71727306	71724062	71724062	Missense_Mutation	C	T	p.R1496Q
SW48_LARGE_INTESTINE	71723941	71727306	71724080	71724080	Missense_Mutation	C	T	p.R1490H
RKO_LARGE_INTESTINE	71723941	71727306	71724104	71724104	Missense_Mutation	G	A	p.A1482V
BT474_BREAST	71723941	71727306	71724114	71724114	Missense_Mutation	C	G	p.E1479Q
HEC59_ENDOMETRIUM	71723941	71727306	71724180	71724180	Missense_Mutation	G	A	p.R1457W
LN428_CENTRAL_NERVOUS_SYSTEM	71723941	71727306	71724251	71724251	Missense_Mutation	T	C	p.Y1433C
BICR6_UPPER_AERODIGESTIVE_TRACT	71723941	71727306	71724260	71724260	Missense_Mutation	T	C	p.K1430R
SKUT1_SOFT_TISSUE	71723941	71727306	71724270	71724270	Missense_Mutation	G	A	p.R1427W
DAUDI_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	71723941	71727306	71724285	71724285	Missense_Mutation	T	C	p.T1422A
RCCER_KIDNEY	71723941	71727306	71724392	71724392	Missense_Mutation	T	G	p.E1386A
REC1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	71723941	71727306	71724524	71724524	Missense_Mutation	G	A	p.A1342V
PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	71723941	71727306	71724584	71724584	Missense_Mutation	G	A	p.A1322V
NCIH1092_LUNG	71723941	71727306	71724588	71724588	Missense_Mutation	G	A	p.R1321C
CL40_LARGE_INTESTINE	71723941	71727306	71724606	71724606	Missense_Mutation	G	C	p.L1315V
HEC108_ENDOMETRIUM	71723941	71727306	71724622	71724622	Missense_Mutation	C	G	p.E1309D
NCIH2110_LUNG	71723941	71727306	71724645	71724645	Missense_Mutation	C	T	p.E1302K
SKRC20_KIDNEY	71723941	71727306	71724678	71724678	Missense_Mutation	G	A	p.R1291W
FARAGE_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	71723941	71727306	71724692	71724692	Missense_Mutation	C	T	p.R1286H
HEC108_ENDOMETRIUM	71723941	71727306	71724779	71724779	Missense_Mutation	G	A	p.A1257V
CAL51_BREAST	71723941	71727306	71724814	71724814	Missense_Mutation	C	G	p.E1245D
OCILY132_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	71723941	71727306	71724834	71724834	Missense_Mutation	G	A	p.R1239C
JHUEM7_ENDOMETRIUM	71723941	71727306	71724902	71724902	Missense_Mutation	C	T	p.G1216D
HEC59_ENDOMETRIUM	71723941	71727306	71724905	71724905	Missense_Mutation	C	T	p.R1215Q
MFE319_ENDOMETRIUM	71723941	71727306	71724941	71724941	Missense_Mutation	C	T	p.S1203N
SAOS2_BONE	71723941	71727306	71724989	71724989	Missense_Mutation	G	C	p.S1187W
MC116_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	71723941	71727306	71725040	71725040	Missense_Mutation	T	G	p.Q1170P
COV362_OVARY	71723941	71727306	71725071	71725071	Missense_Mutation	G	A	p.R1160W
SNU466_CENTRAL_NERVOUS_SYSTEM	71723941	71727306	71725083	71725083	Missense_Mutation	A	G	p.S1156P
HUTU80_SMALL_INTESTINE	71723941	71727306	71725245	71725245	Missense_Mutation	C	T	p.A1102T
SNU175_LARGE_INTESTINE	71723941	71727306	71725245	71725245	Missense_Mutation	C	T	p.A1102T
LU165_LUNG	71723941	71727306	71725299	71725299	Missense_Mutation	G	A	p.R1084W
HCT15_LARGE_INTESTINE	71723941	71727306	71725379	71725379	Missense_Mutation	G	A	p.T1057M
HRT18_LARGE_INTESTINE	71723941	71727306	71725424	71725424	Missense_Mutation	C	T	p.R1042H
SW1116_LARGE_INTESTINE	71723941	71727306	71725446	71725446	Missense_Mutation	G	C	p.Q1035E
22RV1_PROSTATE	71723941	71727306	71725452	71725452	Missense_Mutation	G	A	p.R1033W
HCC202_BREAST	71723941	71727306	71725458	71725458	Missense_Mutation	C	G	p.E1031Q
SNU1040_LARGE_INTESTINE	71723941	71727306	71725512	71725512	Missense_Mutation	G	A	p.R1013W
P30OHK_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	71723941	71727306	71725529	71725529	Missense_Mutation	G	A	p.A1007V
MEWO_SKIN	71723941	71727306	71725574	71725574	Missense_Mutation	T	A	p.Q992L
C33A_CERVIX	71723941	71727306	71725577	71725577	Missense_Mutation	C	T	p.S991N
SARC9371_BONE	71723941	71727306	71725601	71725601	Missense_Mutation	C	T	p.R983Q
TCCSUP_URINARY_TRACT	71723941	71727306	71725601	71725601	Missense_Mutation	C	T	p.R983Q
HO1U1_UPPER_AERODIGESTIVE_TRACT	71723941	71727306	71725602	71725602	Missense_Mutation	G	A	p.R983W
CW2_LARGE_INTESTINE	71723941	71727306	71725908	71725908	Missense_Mutation	G	T	p.L881M
NCC021_KIDNEY	71723941	71727306	71726064	71726064	Missense_Mutation	C	T	p.A829T
MOLT3_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	71723941	71727306	71726103	71726103	Missense_Mutation	G	A	p.R816W
FUOV1_OVARY	71723941	71727306	71726180	71726180	Missense_Mutation	G	A	p.A790V
LS180_LARGE_INTESTINE	71723941	71727306	71726225	71726225	Missense_Mutation	C	A	p.G775V
HEC108_ENDOMETRIUM	71723941	71727306	71726340	71726340	Missense_Mutation	A	T	p.S737T
NCIH748_LUNG	71723941	71727306	71726388	71726388	Missense_Mutation	C	T	p.E721K
NCIH209_LUNG	71723941	71727306	71726473	71726473	Missense_Mutation	C	G	p.R692S
EFM19_BREAST	71723941	71727306	71726498	71726498	Missense_Mutation	T	A	p.Q684L
NCIH513_PLEURA	71723941	71727306	71726502	71726502	Missense_Mutation	C	G	p.E683Q
NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	71723941	71727306	71726505	71726505	Missense_Mutation	A	C	p.S682A
HCT15_LARGE_INTESTINE	71723941	71727306	71726508	71726508	Missense_Mutation	G	A	p.R681W
HRT18_LARGE_INTESTINE	71723941	71727306	71726508	71726508	Missense_Mutation	G	A	p.R681W
ECC12_STOMACH	71723941	71727306	71726642	71726642	Missense_Mutation	G	A	p.T636I
SNU1040_LARGE_INTESTINE	71723941	71727306	71726670	71726670	Missense_Mutation	C	T	p.A627T
OCUBM_BREAST	71723941	71727306	71726747	71726747	Missense_Mutation	G	A	p.A601V
SF172_CENTRAL_NERVOUS_SYSTEM	71723941	71727306	71726759	71726759	Missense_Mutation	C	T	p.R597K
UMUC5_URINARY_TRACT	71723941	71727306	71726848	71726848	Missense_Mutation	C	G	p.L567F
SW1417_LARGE_INTESTINE	71723941	71727306	71726856	71726856	Missense_Mutation	G	T	p.Q565K
TE4_OESOPHAGUS	71723941	71727306	71727071	71727071	Missense_Mutation	C	T	p.G493E
A704_KIDNEY	71723941	71727306	71727123	71727123	Missense_Mutation	A	G	p.S476P
TE617T_SOFT_TISSUE	71723941	71727306	71727177	71727177	Missense_Mutation	C	T	p.E458K
UMUC5_URINARY_TRACT	71723941	71727306	71727179	71727179	Missense_Mutation	A	C	p.F457C
CL11_LARGE_INTESTINE	71723941	71727306	71727188	71727188	Missense_Mutation	C	T	p.R454Q
SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	71723941	71727306	71727188	71727188	Missense_Mutation	C	T	p.R454Q
NCIH2087_LUNG	71723941	71727306	71727213	71727213	Missense_Mutation	G	T	p.Q446K
NCIH508_LARGE_INTESTINE	71732250	71732337	71732277	71732277	Missense_Mutation	C	G	p.E145Q
MZ7MEL_SKIN	71740251	71740336	71740285	71740285	Missense_Mutation	C	T	p.D32N
PCI30_UPPER_AERODIGESTIVE_TRACT	71746948	71747021	71746976	71746976	Missense_Mutation	G	A	p.A5V
SNU503_LARGE_INTESTINE	71723941	71727306	71723970	71723970	Nonsense_Mutation	G	A	p.Q1527*
639V_URINARY_TRACT	71723941	71727306	71724831	71724831	Nonsense_Mutation	G	A	p.Q1240*
MKN74_STOMACH	71723941	71727306	71726241	71726241	Nonsense_Mutation	G	A	p.R770*
MKN28_STOMACH	71723941	71727306	71726241	71726241	Nonsense_Mutation	G	A	p.R770*
CCRFCEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	71723941	71727306	71726319	71726319	Nonsense_Mutation	G	A	p.R744*
22RV1_PROSTATE	71740251	71740336	71740294	71740294	Nonsense_Mutation	G	A	p.Q29*
EFO21_OVARY	71723447	71723488	71723446	71723448	Splice_Site	CCT	-	p.1550_1551QV>L
SKNDZ_AUTONOMIC_GANGLIA	71723447	71723488	71723446	71723448	Splice_Site	CCT	-	p.1550_1551QV>L

Top

Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for NUMA1

sQTL information located at the skipped exons.

Exon skip ID

Chromosome

Three exons

Skippped exon

ENST

Cancer type

SNP id

Location

DNA change (ref/var)

P-value

Top

Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for NUMA1

Top

Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for NUMA1

Top

RelatedDrugs for NUMA1

Approved drugs targeting this gene.
(DrugBank Version 5.1.0 2018-04-02)

Gene

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

RelatedDiseases for NUMA1

Diseases associated with this gene.
(DisGeNet 4.0)

Gene	Disease ID	Disease name	# pubmeds	Source
NUMA1	C0162820	Dermatitis, Allergic Contact	1	CTD_human

	Gene summary
	Gene structures and expression levels
	Exon skipping events with PSIs in TCGA
	Exon skipping events with PSIs in GTEx
	Open reading frame (ORF) annotation in the exon skipping event
	Exon skipping events in the canonical protein sequence
	SNVs in the skipped exons with depth of coverage
	Splicing Quantitative Trait Loci (sQTLs) in the skipped exons
	Splicing Quantitative Trait Methylation (sQTM) in the skipped exon
	Related drugs with this gene
	Related diseases with this gene

Home

Download

Statistics

Landscape

Help

Contact