|
||||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | Open reading frame (ORF) annotation in the exon skipping event |
![]() | |
![]() | |
![]() | Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
![]() | Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
![]() | |
![]() |
Gene summary for NFE2L2 |
Gene summary |
| Gene information | Gene symbol | NFE2L2 | Gene ID | 4780 |
| Gene name | nuclear factor, erythroid 2 like 2 | |
| Synonyms | HEBP1|IMDDHH|NRF2 | |
| Cytomap | 2q31.2 | |
| Type of gene | protein-coding | |
| Description | nuclear factor erythroid 2-related factor 2nuclear factor erythroid-derived 2-like 2 | |
| Modification date | 20180527 | |
| UniProtAcc | Q16236 | |
| Context | PubMed: NFE2L2 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| NFE2L2 | GO:0010499 | proteasomal ubiquitin-independent protein catabolic process | 19424503 |
| NFE2L2 | GO:0016567 | protein ubiquitination | 15983046 |
| NFE2L2 | GO:0043161 | proteasome-mediated ubiquitin-dependent protein catabolic process | 15983046 |
| NFE2L2 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 17015834 |
| NFE2L2 | GO:0071498 | cellular response to fluid shear stress | 25190803 |
Top |
Exon skipping events across known transcript of Ensembl for NFE2L2 from UCSC genome browser |
Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Gene isoform structures and expression levels for NFE2L2 |
Expression levels of gene isoforms across TCGA. |
Expression levels of gene isoforms across GTEx. |
Top |
Exon skipping events with PSIs in TCGA for NFE2L2 |
Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_345137 | 2 | 178096578:178096736:178097119:178097290:178097977:178098067 | 178097119:178097290 | ENSG00000116044.11 | ENST00000446151.2 |
| exon_skip_345138 | 2 | 178096578:178096736:178097119:178097311:178097977:178098067 | 178097119:178097311 | ENSG00000116044.11 | ENST00000464747.1,ENST00000586532.1,ENST00000397062.3,ENST00000397063.4,ENST00000421929.1,ENST00000448782.1 |
| exon_skip_345142 | 2 | 178097226:178097311:178097977:178098067:178098732:178098999 | 178097977:178098067 | ENSG00000116044.11 | ENST00000588123.1,ENST00000464747.1,ENST00000586532.1,ENST00000397062.3,ENST00000397063.4,ENST00000421929.1,ENST00000448782.1 |
| exon_skip_345147 | 2 | 178097977:178098067:178098732:178098999:178128130:178128182 | 178098732:178098999 | ENSG00000116044.11 | ENST00000423513.1,ENST00000446151.2,ENST00000397063.4 |
| exon_skip_345148 | 2 | 178097977:178098067:178098732:178098999:178129259:178129387 | 178098732:178098999 | ENSG00000116044.11 | ENST00000397062.3 |
| exon_skip_345152 | 2 | 178098981:178098999:178148327:178148532:178152338:178152505 | 178148327:178148532 | ENSG00000116044.11 | ENST00000588123.1 |
| exon_skip_345165 | 2 | 178098981:178098999:178175691:178175763:178175960:178176005 | 178175691:178175763 | ENSG00000116044.11 | ENST00000586532.1 |
| exon_skip_345205 | 2 | 178199120:178199257:178203325:178203427:178257300:178257425 | 178203325:178203427 | ENSG00000116044.11 | ENST00000464747.1 |
PSI values of skipped exons in TCGA. |
Top |
Exon skipping events with PSIs in GTEx for NFE2L2 |
Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_345137 | 2 | 178096578:178096736:178097119:178097290:178097977:178098067 | 178097119:178097290 | ENSG00000116044.11 | ENST00000446151.2 |
| exon_skip_345138 | 2 | 178096578:178096736:178097119:178097311:178097977:178098067 | 178097119:178097311 | ENSG00000116044.11 | ENST00000397063.4,ENST00000397062.3,ENST00000464747.1,ENST00000448782.1,ENST00000586532.1,ENST00000421929.1 |
| exon_skip_345142 | 2 | 178097226:178097311:178097977:178098067:178098732:178098999 | 178097977:178098067 | ENSG00000116044.11 | ENST00000397063.4,ENST00000397062.3,ENST00000464747.1,ENST00000448782.1,ENST00000586532.1,ENST00000421929.1,ENST00000588123.1 |
| exon_skip_345152 | 2 | 178098981:178098999:178148327:178148532:178152338:178152505 | 178148327:178148532 | ENSG00000116044.11 | ENST00000588123.1 |
| exon_skip_345165 | 2 | 178098981:178098999:178175691:178175763:178175960:178176005 | 178175691:178175763 | ENSG00000116044.11 | ENST00000586532.1 |
| exon_skip_345205 | 2 | 178199120:178199257:178203325:178203427:178257300:178257425 | 178203325:178203427 | ENSG00000116044.11 | ENST00000464747.1 |
PSI values of skipped exons in GTEx. |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for NFE2L2 |
Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000397062 | 178097119 | 178097311 | In-frame |
| ENST00000397062 | 178097977 | 178098067 | In-frame |
| ENST00000397062 | 178098732 | 178098999 | In-frame |
Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000397062 | 178097119 | 178097311 | In-frame |
| ENST00000397062 | 178097977 | 178098067 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for NFE2L2 |
Exon skipping at the protein sequence level and followed lost functional features.* Click on the image to enlarge it in a new window. |
![]() |
Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000397062 | 2870 | 605 | 178098732 | 178098999 | 601 | 867 | 15 | 104 |
| ENST00000397062 | 2870 | 605 | 178097977 | 178098067 | 868 | 957 | 104 | 134 |
| ENST00000397062 | 2870 | 605 | 178097119 | 178097311 | 958 | 1149 | 134 | 198 |
Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000397062 | 2870 | 605 | 178097977 | 178098067 | 868 | 957 | 104 | 134 |
| ENST00000397062 | 2870 | 605 | 178097119 | 178097311 | 958 | 1149 | 134 | 198 |
Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q16236 | 15 | 104 | 1 | 16 | Alternative sequence | ID=VSP_025045;Note=In isoform 2 and isoform 3. Missing;Ontology_term=ECO:0000303,ECO:0000303;evidence=ECO:0000303|PubMed:14702039,ECO:0000303|Ref.2;Dbxref=PMID:14702039 |
| Q16236 | 15 | 104 | 1 | 605 | Chain | ID=PRO_0000076449;Note=Nuclear factor erythroid 2-related factor 2 |
| Q16236 | 15 | 104 | 40 | 40 | Modified residue | Note=Phosphoserine%3B by PKC;Ontology_term=ECO:0000250;evidence=ECO:0000250|UniProtKB:O54968 |
| Q16236 | 15 | 104 | 80 | 80 | Mutagenesis | Note=Loss of interaction with KEAP1. T->A;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:16888629;Dbxref=PMID:16888629 |
| Q16236 | 15 | 104 | 31 | 31 | Natural variant | ID=VAR_080492;Note=In IMDDHH. G->R;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:29018201;Dbxref=PMID:29018201 |
| Q16236 | 15 | 104 | 43 | 43 | Natural variant | ID=VAR_032110;Note=R->Q;Dbxref=dbSNP:rs35248500 |
| Q16236 | 15 | 104 | 79 | 79 | Natural variant | ID=VAR_080493;Note=In IMDDHH. E->K;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:29018201;Dbxref=PMID:29018201 |
| Q16236 | 15 | 104 | 80 | 80 | Natural variant | ID=VAR_080494;Note=In IMDDHH%3B increased protein abundance%3B increased positive regulation of transcription of target genes%3B changed cell redox homeostasis. T->K;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:29018201;Dbxref=PMID:29018201 |
| Q16236 | 15 | 104 | 81 | 81 | Natural variant | ID=VAR_080495;Note=In IMDDHH. G->S;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:29018201;Dbxref=PMID:29018201 |
| Q16236 | 15 | 104 | 99 | 99 | Natural variant | ID=VAR_020322;Note=S->P;Dbxref=dbSNP:rs5031039 |
| Q16236 | 15 | 104 | 72 | 72 | Sequence conflict | Note=A->T;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| Q16236 | 15 | 104 | 92 | 92 | Sequence conflict | Note=I->T;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| Q16236 | 15 | 104 | 78 | 80 | Turn | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2FLU |
| Q16236 | 104 | 134 | 1 | 605 | Chain | ID=PRO_0000076449;Note=Nuclear factor erythroid 2-related factor 2 |
| Q16236 | 134 | 198 | 135 | 141 | Alternative sequence | ID=VSP_046168;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:14702039;Dbxref=PMID:14702039 |
| Q16236 | 134 | 198 | 1 | 605 | Chain | ID=PRO_0000076449;Note=Nuclear factor erythroid 2-related factor 2 |
| Q16236 | 134 | 198 | 178 | 178 | Sequence conflict | Note=D->Y;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q16236 | 104 | 134 | 1 | 605 | Chain | ID=PRO_0000076449;Note=Nuclear factor erythroid 2-related factor 2 |
| Q16236 | 134 | 198 | 135 | 141 | Alternative sequence | ID=VSP_046168;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:14702039;Dbxref=PMID:14702039 |
| Q16236 | 134 | 198 | 1 | 605 | Chain | ID=PRO_0000076449;Note=Nuclear factor erythroid 2-related factor 2 |
| Q16236 | 134 | 198 | 178 | 178 | Sequence conflict | Note=D->Y;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
Top |
SNVs in the skipped exons for NFE2L2 |
- Lollipop plot for presenting exon skipping associated SNVs.* Click on the image to enlarge it in a new window. |
- Differential PSIs between mutated versus non-mutated samples. |
- Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_345148 exon_skip_345147 | 178098733 | 178098999 | 178098886 | 178098886 | Frame_Shift_Del | T | - | p.K53fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_345148 exon_skip_345147 | 178098733 | 178098999 | 178098895 | 178098895 | Frame_Shift_Del | T | - | p.K50fs |
| CESC | TCGA-C5-A1MH-01 | exon_skip_345148 exon_skip_345147 | 178098733 | 178098999 | 178098900 | 178098900 | Frame_Shift_Del | C | - | p.E49fs |
| UCEC | TCGA-D1-A16N-01 | exon_skip_345148 exon_skip_345147 | 178098733 | 178098999 | 178098885 | 178098886 | Frame_Shift_Ins | - | T | p.K53fs |
| ESCA | TCGA-LN-A5U5-01 | exon_skip_345148 exon_skip_345147 | 178098733 | 178098999 | 178098944 | 178098945 | Frame_Shift_Ins | - | T | p.R34fs |
| CESC | TCGA-C5-A1BL-01 | exon_skip_345137 | 178097120 | 178097290 | 178097218 | 178097218 | Nonsense_Mutation | C | A | p.E166* |
| CESC | TCGA-C5-A1BL-01 | exon_skip_345138 | 178097120 | 178097311 | 178097218 | 178097218 | Nonsense_Mutation | C | A | p.E166* |
| LGG | TCGA-E1-A7YE-01 | exon_skip_345137 | 178097120 | 178097290 | 178097223 | 178097223 | Nonsense_Mutation | G | C | p.S164* |
| LGG | TCGA-E1-A7YE-01 | exon_skip_345138 | 178097120 | 178097311 | 178097223 | 178097223 | Nonsense_Mutation | G | C | p.S164* |
| LIHC | TCGA-DD-A4NO-01 | exon_skip_345148 exon_skip_345147 | 178098733 | 178098999 | 178098810 | 178098810 | Nonsense_Mutation | C | A | p.E79* |
| LIHC | TCGA-DD-A4NO-01 | exon_skip_345148 exon_skip_345147 | 178098733 | 178098999 | 178098810 | 178098810 | Nonsense_Mutation | C | A | p.E79X |
| LUAD | TCGA-17-Z023-01 | exon_skip_345148 exon_skip_345147 | 178098733 | 178098999 | 178098810 | 178098810 | Nonsense_Mutation | C | A | p.E79* |
- Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
- Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| HEC151_ENDOMETRIUM | 178098733 | 178098999 | 178098976 | 178098979 | Frame_Shift_Del | AAGT | - | p.IL22fs |
| DND41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 178098733 | 178098999 | 178098846 | 178098847 | Frame_Shift_Ins | - | T | p.E67fs |
| NCIH1568_LUNG | 178098733 | 178098999 | 178098808 | 178098816 | In_Frame_Del | CTCTTCATC | - | p.DEE77del |
| TE6_OESOPHAGUS | 178098733 | 178098999 | 178098814 | 178098834 | In_Frame_Del | ATCTAGTTGTAACTGAGCGAA | - | p.FAQLQLD71del |
| NCIH748_LUNG | 178097120 | 178097311 | 178097191 | 178097191 | Missense_Mutation | C | A | p.V175F |
| NCIH748_LUNG | 178097120 | 178097290 | 178097191 | 178097191 | Missense_Mutation | C | A | p.V175F |
| HCC2450_LUNG | 178097120 | 178097311 | 178097278 | 178097278 | Missense_Mutation | C | T | p.D146N |
| HCC2450_LUNG | 178097120 | 178097290 | 178097278 | 178097278 | Missense_Mutation | C | T | p.D146N |
| LS513_LARGE_INTESTINE | 178097120 | 178097311 | 178097298 | 178097298 | Missense_Mutation | G | T | p.T139K |
| DOTC24510_CERVIX | 178097978 | 178098067 | 178097980 | 178097980 | Missense_Mutation | C | T | p.E134K |
| CALU1_LUNG | 178097978 | 178098067 | 178097997 | 178097997 | Missense_Mutation | G | A | p.P128L |
| HO1U1_UPPER_AERODIGESTIVE_TRACT | 178098733 | 178098999 | 178098799 | 178098799 | Missense_Mutation | T | A | p.E82D |
| 253J_URINARY_TRACT | 178098733 | 178098999 | 178098804 | 178098804 | Missense_Mutation | C | T | p.G81S |
| 253JBV_URINARY_TRACT | 178098733 | 178098999 | 178098804 | 178098804 | Missense_Mutation | C | T | p.G81S |
| BB49HNC_UPPER_AERODIGESTIVE_TRACT | 178098733 | 178098999 | 178098804 | 178098804 | Missense_Mutation | C | T | p.G81S |
| OE21_OESOPHAGUS | 178098733 | 178098999 | 178098804 | 178098804 | Missense_Mutation | C | T | p.G81S |
| KYSE520_OESOPHAGUS | 178098733 | 178098999 | 178098806 | 178098806 | Missense_Mutation | G | A | p.T80I |
| CAL39_VULVA | 178098733 | 178098999 | 178098806 | 178098806 | Missense_Mutation | G | C | p.T80R |
| LK2_LUNG | 178098733 | 178098999 | 178098810 | 178098810 | Missense_Mutation | C | T | p.E79K |
| MESSA_SOFT_TISSUE | 178098733 | 178098999 | 178098810 | 178098810 | Missense_Mutation | C | T | p.E79K |
| KYSE180_OESOPHAGUS | 178098733 | 178098999 | 178098815 | 178098815 | Missense_Mutation | T | A | p.D77V |
| EBC1_LUNG | 178098733 | 178098999 | 178098815 | 178098815 | Missense_Mutation | T | A | p.D77V |
| SW579_THYROID | 178098733 | 178098999 | 178098816 | 178098816 | Missense_Mutation | C | A | p.D77Y |
| CGTHW1_THYROID | 178098733 | 178098999 | 178098816 | 178098816 | Missense_Mutation | C | A | p.D77Y |
| SW156_KIDNEY | 178098733 | 178098999 | 178098816 | 178098816 | Missense_Mutation | C | A | p.D77Y |
| IGR1_SKIN | 178098733 | 178098999 | 178098826 | 178098826 | Missense_Mutation | C | G | p.Q73H |
| HCC2450_LUNG | 178098733 | 178098999 | 178098840 | 178098840 | Missense_Mutation | C | G | p.A69P |
| HEC265_ENDOMETRIUM | 178098733 | 178098999 | 178098944 | 178098944 | Missense_Mutation | C | G | p.R34P |
| BC3C_URINARY_TRACT | 178098733 | 178098999 | 178098944 | 178098944 | Missense_Mutation | C | T | p.R34Q |
| HCC2814_LUNG | 178098733 | 178098999 | 178098944 | 178098944 | Missense_Mutation | C | T | p.R34Q |
| LB771HNC_UPPER_AERODIGESTIVE_TRACT | 178098733 | 178098999 | 178098945 | 178098945 | Missense_Mutation | G | C | p.R34G |
| NCIH2228_LUNG | 178098733 | 178098999 | 178098953 | 178098953 | Missense_Mutation | C | G | p.G31A |
| RCCER_KIDNEY | 178098733 | 178098999 | 178098953 | 178098953 | Missense_Mutation | C | G | p.G31A |
| HEC1A_ENDOMETRIUM | 178098733 | 178098999 | 178098954 | 178098954 | Missense_Mutation | C | T | p.G31R |
| HEC1_ENDOMETRIUM | 178098733 | 178098999 | 178098954 | 178098954 | Missense_Mutation | C | T | p.G31R |
| HEC1B_ENDOMETRIUM | 178098733 | 178098999 | 178098954 | 178098954 | Missense_Mutation | C | T | p.G31R |
| TE11_OESOPHAGUS | 178098733 | 178098999 | 178098959 | 178098959 | Missense_Mutation | T | C | p.D29G |
| SKGIIIA_CERVIX | 178098733 | 178098999 | 178098959 | 178098959 | Missense_Mutation | T | A | p.D29V |
| BICR16_UPPER_AERODIGESTIVE_TRACT | 178098733 | 178098999 | 178098960 | 178098960 | Missense_Mutation | C | G | p.D29H |
| TE14_OESOPHAGUS | 178098733 | 178098999 | 178098960 | 178098960 | Missense_Mutation | C | G | p.D29H |
| RERFLCSQ1_LUNG | 178098733 | 178098999 | 178098960 | 178098960 | Missense_Mutation | C | G | p.D29H |
| HA7RCC_KIDNEY | 178098733 | 178098999 | 178098965 | 178098965 | Missense_Mutation | T | G | p.D27A |
| CORL88_LUNG | 178098733 | 178098999 | 178098968 | 178098968 | Missense_Mutation | T | G | p.Q26P |
| SNU1040_LARGE_INTESTINE | 178098733 | 178098999 | 178098972 | 178098972 | Missense_Mutation | T | C | p.R25G |
| KYSE70_OESOPHAGUS | 178098733 | 178098999 | 178098973 | 178098973 | Missense_Mutation | C | A | p.W24C |
| KMH2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 178098733 | 178098999 | 178098981 | 178098981 | Missense_Mutation | T | C | p.I22V |
| LC1SQSF_LUNG | 178098733 | 178098999 | 178098950 | 178102746 | Splice_Site | ACTCCAAGATCTATATCTTGCCTCCAAAGTATGTCAATCAAATCCATGTCCTATGTTTAAGACAAAAAAAGGAAGGAGAGAGCTCATGTTTTTTAAATGACAGATACCACATAAATTAATTCACATTATGCCACTGTTGATGGTGGGAAGTGGGGAGATTACAAATACAATCTAAATGAGAACACAGATCCAATGTTCTAGAAGAGCACAGTTAATTCCATTCAATGAATCTATTCATTAAAGACAACAAACAAC | - | p.SIKIAGSCIPFIFGAST16fs |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for NFE2L2 |
sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for NFE2L2 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for NFE2L2 |
Top |
RelatedDrugs for NFE2L2 |
Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for NFE2L2 |
Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| NFE2L2 | C4277682 | Chemical and Drug Induced Liver Injury | 4 | CTD_human |
| NFE2L2 | C0007131 | Non-Small Cell Lung Carcinoma | 2 | CTD_human |
| NFE2L2 | C0033578 | Prostatic Neoplasms | 2 | CTD_human |
| NFE2L2 | C0007137 | Squamous cell carcinoma | 1 | CTD_human |
| NFE2L2 | C0008370 | Cholestasis | 1 | CTD_human |
| NFE2L2 | C0011881 | Diabetic Nephropathy | 1 | CTD_human |
| NFE2L2 | C0013990 | Pathological accumulation of air in tissues | 1 | CTD_human |
| NFE2L2 | C0014072 | Experimental Autoimmune Encephalomyelitis | 1 | CTD_human |
| NFE2L2 | C0014170 | Endometrial Neoplasms | 1 | CTD_human |
| NFE2L2 | C0017178 | Gastrointestinal Diseases | 1 | CTD_human |
| NFE2L2 | C0020456 | Hyperglycemia | 1 | CTD_human |
| NFE2L2 | C0020507 | Hyperplasia | 1 | CTD_human |
| NFE2L2 | C0022593 | Keratosis | 1 | CTD_human |
| NFE2L2 | C0022658 | Kidney Diseases | 1 | CTD_human |
| NFE2L2 | C0023890 | Liver Cirrhosis | 1 | CTD_human |
| NFE2L2 | C0023893 | Liver Cirrhosis, Experimental | 1 | CTD_human |
| NFE2L2 | C0023903 | Liver neoplasms | 1 | CTD_human |
| NFE2L2 | C0027540 | Necrosis | 1 | CTD_human |
| NFE2L2 | C0034069 | Pulmonary Fibrosis | 1 | CTD_human |
| NFE2L2 | C0037286 | Skin Neoplasms | 1 | CTD_human |
| NFE2L2 | C0041755 | Adverse reaction to drug | 1 | CTD_human |
| NFE2L2 | C0085215 | Ovarian Failure, Premature | 1 | CTD_human |
| NFE2L2 | C0162820 | Dermatitis, Allergic Contact | 1 | CTD_human |
| NFE2L2 | C0235032 | Neurotoxicity Syndromes | 1 | CTD_human |
| NFE2L2 | C0242488 | Acute Lung Injury | 1 | CTD_human |
| NFE2L2 | C0279626 | Squamous cell carcinoma of esophagus | 1 | CTD_human |
| NFE2L2 | C0400966 | Non-alcoholic Fatty Liver Disease | 1 | CTD_human |
| NFE2L2 | C0887833 | Carcinoma, Pancreatic Ductal | 1 | CTD_human |
| NFE2L2 | C2239176 | Liver carcinoma | 1 | CTD_human |
| NFE2L2 | C2609414 | Acute kidney injury | 1 | CTD_human |