|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for MET |
 Gene summary |
| Gene information | Gene symbol | MET | Gene ID | 4233 |
| Gene name | MET proto-oncogene, receptor tyrosine kinase | |
| Synonyms | AUTS9|DFNB97|HGFR|RCCP2|c-Met | |
| Cytomap | 7q31.2 | |
| Type of gene | protein-coding | |
| Description | hepatocyte growth factor receptorHGF receptorHGF/SF receptorSF receptorproto-oncogene c-Metscatter factor receptortyrosine-protein kinase Met | |
| Modification date | 20180523 | |
| UniProtAcc | P08581 | |
| Context | PubMed: MET [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) - Pharmacokinetics and safety of single doses of drisapersen in non-ambulant subjects with Duchenne muscular dystrophy: results of a double-blind randomized clinical trial.(24321374) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| MET | GO:0001886 | endothelial cell morphogenesis | 14500721 |
| MET | GO:0035024 | negative regulation of Rho protein signal transduction | 25198505 |
| MET | GO:0045944 | positive regulation of transcription by RNA polymerase II | 22521434 |
| MET | GO:0050918 | positive chemotaxis | 15218527 |
| MET | GO:0051497 | negative regulation of stress fiber assembly | 25198505 |
| MET | GO:0070495 | negative regulation of thrombin-activated receptor signaling pathway | 25198505 |
| MET | GO:0071526 | semaphorin-plexin signaling pathway | 15218527 |
| MET | GO:1905098 | negative regulation of guanyl-nucleotide exchange factor activity | 25198505 |
Top |
Exon skipping events across known transcript of Ensembl for MET from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for MET |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for MET |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_470669 | 7 | 116312458:116312631:116339124:116340338:116371721:116371913 | 116339124:116340338 | ENSG00000105976.10 | ENST00000397752.3,ENST00000318493.6 |
| exon_skip_470675 | 7 | 116339138:116340338:116371721:116371913:116380003:116380138 | 116371721:116371913 | ENSG00000105976.10 | ENST00000397752.3,ENST00000436117.2,ENST00000318493.6 |
| exon_skip_470679 | 7 | 116380905:116381079:116395408:116395569:116397490:116397593 | 116395408:116395569 | ENSG00000105976.10 | ENST00000397752.3,ENST00000436117.2,ENST00000318493.6 |
| exon_skip_470681 | 7 | 116398570:116398674:116399390:116399544:116403103:116403134 | 116399390:116399544 | ENSG00000105976.10 | ENST00000318493.6 |
| exon_skip_470682 | 7 | 116398570:116398674:116399444:116399544:116403103:116403134 | 116399444:116399544 | ENSG00000105976.10 | ENST00000397752.3,ENST00000422097.1 |
| exon_skip_470683 | 7 | 116411551:116411708:116411902:116412043:116414934:116415126 | 116411902:116412043 | ENSG00000105976.10 | ENST00000397752.3,ENST00000318493.6 |
| exon_skip_470684 | 7 | 116411902:116412043:116414934:116415165:116417442:116417523 | 116414934:116415165 | ENSG00000105976.10 | ENST00000397752.3,ENST00000318493.6 |
| exon_skip_470687 | 7 | 116417442:116417523:116418829:116419011:116422041:116422151 | 116418829:116419011 | ENSG00000105976.10 | ENST00000539704.1,ENST00000397752.3,ENST00000318493.6 |
| exon_skip_470690 | 7 | 116422041:116422151:116423357:116423523:116435708:116435845 | 116423357:116423523 | ENSG00000105976.10 | ENST00000539704.1,ENST00000397752.3,ENST00000318493.6 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for MET |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_470669 | 7 | 116312458:116312631:116339124:116340338:116371721:116371913 | 116339124:116340338 | ENSG00000105976.10 | ENST00000397752.3,ENST00000318493.6 |
| exon_skip_470681 | 7 | 116398570:116398674:116399390:116399544:116403103:116403134 | 116399390:116399544 | ENSG00000105976.10 | ENST00000318493.6 |
| exon_skip_470682 | 7 | 116398570:116398674:116399444:116399544:116403103:116403134 | 116399444:116399544 | ENSG00000105976.10 | ENST00000397752.3,ENST00000422097.1 |
| exon_skip_470683 | 7 | 116411551:116411708:116411902:116412043:116414934:116415126 | 116411902:116412043 | ENSG00000105976.10 | ENST00000397752.3,ENST00000318493.6 |
| exon_skip_470687 | 7 | 116417442:116417523:116418829:116419011:116422041:116422151 | 116418829:116419011 | ENSG00000105976.10 | ENST00000397752.3,ENST00000318493.6,ENST00000539704.1 |
| exon_skip_470690 | 7 | 116422041:116422151:116423357:116423523:116435708:116435845 | 116423357:116423523 | ENSG00000105976.10 | ENST00000397752.3,ENST00000318493.6,ENST00000539704.1 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for MET |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000397752 | 116339124 | 116340338 | 5CDS-5UTR |
| ENST00000397752 | 116395408 | 116395569 | Frame-shift |
| ENST00000397752 | 116399444 | 116399544 | Frame-shift |
| ENST00000397752 | 116418829 | 116419011 | Frame-shift |
| ENST00000397752 | 116423357 | 116423523 | Frame-shift |
| ENST00000397752 | 116371721 | 116371913 | In-frame |
| ENST00000397752 | 116411902 | 116412043 | In-frame |
| ENST00000397752 | 116414934 | 116415165 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000397752 | 116339124 | 116340338 | 5CDS-5UTR |
| ENST00000397752 | 116399444 | 116399544 | Frame-shift |
| ENST00000397752 | 116418829 | 116419011 | Frame-shift |
| ENST00000397752 | 116423357 | 116423523 | Frame-shift |
| ENST00000397752 | 116411902 | 116412043 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for MET |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000397752 | 6652 | 1390 | 116371721 | 116371913 | 1401 | 1592 | 400 | 464 |
| ENST00000397752 | 6652 | 1390 | 116411902 | 116412043 | 3088 | 3228 | 962 | 1009 |
| ENST00000397752 | 6652 | 1390 | 116414934 | 116415165 | 3229 | 3459 | 1009 | 1086 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000397752 | 6652 | 1390 | 116411902 | 116412043 | 3088 | 3228 | 962 | 1009 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| P08581 | 400 | 464 | 418 | 422 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2UZX |
| P08581 | 400 | 464 | 424 | 427 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2UZX |
| P08581 | 400 | 464 | 439 | 447 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2UZX |
| P08581 | 400 | 464 | 450 | 457 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2UZX |
| P08581 | 400 | 464 | 462 | 466 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2UZX |
| P08581 | 400 | 464 | 25 | 1390 | Chain | ID=PRO_0000024440;Note=Hepatocyte growth factor receptor |
| P08581 | 400 | 464 | 27 | 515 | Domain | Note=Sema;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00352 |
| P08581 | 400 | 464 | 405 | 405 | Glycosylation | Note=N-linked (GlcNAc...) asparagine;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| P08581 | 400 | 464 | 25 | 932 | Topological domain | Note=Extracellular;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| P08581 | 400 | 464 | 429 | 436 | Turn | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2UZX |
| P08581 | 962 | 1009 | 765 | 1390 | Alternative sequence | ID=VSP_042448;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:18593464;Dbxref=PMID:18593464 |
| P08581 | 962 | 1009 | 25 | 1390 | Chain | ID=PRO_0000024440;Note=Hepatocyte growth factor receptor |
| P08581 | 962 | 1009 | 966 | 966 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:24275569;Dbxref=PMID:24275569 |
| P08581 | 962 | 1009 | 977 | 977 | Modified residue | Note=Phosphothreonine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:18691976;Dbxref=PMID:18691976 |
| P08581 | 962 | 1009 | 990 | 990 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244,ECO:0000244;evidence=ECO:0000244|PubMed:18669648,ECO:0000244|PubMed:23186163;Dbxref=PMID:18669648,PMID:23186163 |
| P08581 | 962 | 1009 | 997 | 997 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:18669648;Dbxref=PMID:18669648 |
| P08581 | 962 | 1009 | 1000 | 1000 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:18669648;Dbxref=PMID:18669648 |
| P08581 | 962 | 1009 | 1003 | 1003 | Modified residue | Note=Phosphotyrosine;Ontology_term=ECO:0000244,ECO:0000244;evidence=ECO:0000244|PubMed:18691976,ECO:0000244|PubMed:19369195;Dbxref=PMID:18691976,PMID:19369195 |
| P08581 | 962 | 1009 | 964 | 1010 | Natural variant | ID=VAR_076584;Note=In OSFD%3B loss of CBL-mediated destabilization. Missing;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:26637977;Dbxref=PMID:26637977 |
| P08581 | 962 | 1009 | 970 | 970 | Natural variant | ID=VAR_032482;Note=R->C;Ontology_term=ECO:0000269,ECO:0000269;evidence=ECO:0000269|PubMed:17053076,ECO:0000269|PubMed:17344846;Dbxref=dbSNP:rs34589476,PMID:17053076,PMID:17344846 |
| P08581 | 962 | 1009 | 991 | 991 | Natural variant | ID=VAR_032483;Note=In gastric cancer%3B prolonged tyrosine phosphorylation in response to HGF/SF%3B transforming activity in athymic nude mice. P->S;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:11042681;Dbxref=dbSNP:rs768678989,PMID:11042681 |
| P08581 | 962 | 1009 | 992 | 992 | Natural variant | ID=VAR_032484;Note=Found in a case of cancer of unknown primary origin%3B the mutated receptor is still functional and can sustain the transformed phenotype%3B somatic mutation. T->I;Ontology_term=ECO:0000269,ECO:0000269,ECO:0000269,ECO:0000269;evidence=E |
| P08581 | 962 | 1009 | 1003 | 1003 | Natural variant | ID=VAR_076585;Note=Probable disease-associated mutation found in lesional sample from a patient with sporadically occurring%2C unilateral osteofibrous dysplasia%3B somatic mutation%3B complete loss of ligand-induced CBL-mediated ubiquitination%2C resultin |
| P08581 | 962 | 1009 | 1003 | 1003 | Site | Note=Required for ligand-induced CBL-mediated ubiquitination;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:12244174;Dbxref=PMID:12244174 |
| P08581 | 962 | 1009 | 1009 | 1010 | Site | Note=Breakpoint for translocation to form TPR-MET oncogene |
| P08581 | 962 | 1009 | 956 | 1390 | Topological domain | Note=Cytoplasmic;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| P08581 | 1009 | 1086 | 765 | 1390 | Alternative sequence | ID=VSP_042448;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:18593464;Dbxref=PMID:18593464 |
| P08581 | 1009 | 1086 | 1076 | 1087 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:4R1V |
| P08581 | 1009 | 1086 | 25 | 1390 | Chain | ID=PRO_0000024440;Note=Hepatocyte growth factor receptor |
| P08581 | 1009 | 1086 | 1078 | 1345 | Domain | Note=Protein kinase;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00159 |
| P08581 | 1009 | 1086 | 1048 | 1050 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:4EEV |
| P08581 | 1009 | 1086 | 1055 | 1057 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:3F66 |
| P08581 | 1009 | 1086 | 1060 | 1066 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:4R1V |
| P08581 | 1009 | 1086 | 1067 | 1069 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:4R1V |
| P08581 | 1009 | 1086 | 1073 | 1075 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:4R1V |
| P08581 | 1009 | 1086 | 964 | 1010 | Natural variant | ID=VAR_076584;Note=In OSFD%3B loss of CBL-mediated destabilization. Missing;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:26637977;Dbxref=PMID:26637977 |
| P08581 | 1009 | 1086 | 1084 | 1092 | Nucleotide binding | Note=ATP;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00159 |
| P08581 | 1009 | 1086 | 1009 | 1010 | Site | Note=Breakpoint for translocation to form TPR-MET oncogene |
| P08581 | 1009 | 1086 | 956 | 1390 | Topological domain | Note=Cytoplasmic;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| P08581 | 962 | 1009 | 765 | 1390 | Alternative sequence | ID=VSP_042448;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:18593464;Dbxref=PMID:18593464 |
| P08581 | 962 | 1009 | 25 | 1390 | Chain | ID=PRO_0000024440;Note=Hepatocyte growth factor receptor |
| P08581 | 962 | 1009 | 966 | 966 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:24275569;Dbxref=PMID:24275569 |
| P08581 | 962 | 1009 | 977 | 977 | Modified residue | Note=Phosphothreonine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:18691976;Dbxref=PMID:18691976 |
| P08581 | 962 | 1009 | 990 | 990 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244,ECO:0000244;evidence=ECO:0000244|PubMed:18669648,ECO:0000244|PubMed:23186163;Dbxref=PMID:18669648,PMID:23186163 |
| P08581 | 962 | 1009 | 997 | 997 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:18669648;Dbxref=PMID:18669648 |
| P08581 | 962 | 1009 | 1000 | 1000 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:18669648;Dbxref=PMID:18669648 |
| P08581 | 962 | 1009 | 1003 | 1003 | Modified residue | Note=Phosphotyrosine;Ontology_term=ECO:0000244,ECO:0000244;evidence=ECO:0000244|PubMed:18691976,ECO:0000244|PubMed:19369195;Dbxref=PMID:18691976,PMID:19369195 |
| P08581 | 962 | 1009 | 964 | 1010 | Natural variant | ID=VAR_076584;Note=In OSFD%3B loss of CBL-mediated destabilization. Missing;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:26637977;Dbxref=PMID:26637977 |
| P08581 | 962 | 1009 | 970 | 970 | Natural variant | ID=VAR_032482;Note=R->C;Ontology_term=ECO:0000269,ECO:0000269;evidence=ECO:0000269|PubMed:17053076,ECO:0000269|PubMed:17344846;Dbxref=dbSNP:rs34589476,PMID:17053076,PMID:17344846 |
| P08581 | 962 | 1009 | 991 | 991 | Natural variant | ID=VAR_032483;Note=In gastric cancer%3B prolonged tyrosine phosphorylation in response to HGF/SF%3B transforming activity in athymic nude mice. P->S;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:11042681;Dbxref=dbSNP:rs768678989,PMID:11042681 |
| P08581 | 962 | 1009 | 992 | 992 | Natural variant | ID=VAR_032484;Note=Found in a case of cancer of unknown primary origin%3B the mutated receptor is still functional and can sustain the transformed phenotype%3B somatic mutation. T->I;Ontology_term=ECO:0000269,ECO:0000269,ECO:0000269,ECO:0000269;evidence=E |
| P08581 | 962 | 1009 | 1003 | 1003 | Natural variant | ID=VAR_076585;Note=Probable disease-associated mutation found in lesional sample from a patient with sporadically occurring%2C unilateral osteofibrous dysplasia%3B somatic mutation%3B complete loss of ligand-induced CBL-mediated ubiquitination%2C resultin |
| P08581 | 962 | 1009 | 1003 | 1003 | Site | Note=Required for ligand-induced CBL-mediated ubiquitination;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:12244174;Dbxref=PMID:12244174 |
| P08581 | 962 | 1009 | 1009 | 1010 | Site | Note=Breakpoint for translocation to form TPR-MET oncogene |
| P08581 | 962 | 1009 | 956 | 1390 | Topological domain | Note=Cytoplasmic;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
Top |
SNVs in the skipped exons for MET |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
MET_LUAD_exon_skip_470683_psi_boxplot.png |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_470669 | 116339125 | 116340338 | 116339289 | 116339289 | Frame_Shift_Del | C | - | p.P51fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_470669 | 116339125 | 116340338 | 116339873 | 116339873 | Frame_Shift_Del | C | - | p.Y245fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_470679 | 116395409 | 116395569 | 116395427 | 116395427 | Frame_Shift_Del | C | - | p.P574fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_470679 | 116395409 | 116395569 | 116395444 | 116395444 | Frame_Shift_Del | A | - | p.T579fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_470679 | 116395409 | 116395569 | 116395452 | 116395452 | Frame_Shift_Del | C | - | p.T582fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_470681 | 116399391 | 116399544 | 116399473 | 116399473 | Frame_Shift_Del | A | - | p.K765fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_470682 | 116399445 | 116399544 | 116399473 | 116399473 | Frame_Shift_Del | A | - | p.K765fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_470681 | 116399391 | 116399544 | 116399473 | 116399473 | Frame_Shift_Del | A | - | p.K765fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_470682 | 116399445 | 116399544 | 116399473 | 116399473 | Frame_Shift_Del | A | - | p.K765fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_470684 | 116414935 | 116415165 | 116415001 | 116415001 | Frame_Shift_Del | C | - | p.S1032fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_470690 | 116423358 | 116423523 | 116423366 | 116423366 | Frame_Shift_Del | A | - | p.E1214fs |
| LIHC | TCGA-BC-A112-01 | exon_skip_470669 | 116339125 | 116340338 | 116339931 | 116339932 | Frame_Shift_Ins | - | A | p.K265fs |
| BRCA | TCGA-AR-A0TU-01 | exon_skip_470669 | 116339125 | 116340338 | 116340222 | 116340223 | Frame_Shift_Ins | - | T | p.M362fs |
| SKCM | TCGA-EE-A2A1-06 | exon_skip_470675 | 116371722 | 116371913 | 116371770 | 116371770 | Nonsense_Mutation | C | T | p.R417* |
| UCEC | TCGA-AX-A05Z-01 | exon_skip_470683 | 116411903 | 116412043 | 116411995 | 116411995 | Nonsense_Mutation | G | T | p.E1012* |
| LUAD | TCGA-75-6205-01 | exon_skip_470683 | 116411903 | 116412043 | 116412024 | 116412024 | Nonsense_Mutation | C | G | p.Y1003* |
| SKCM | TCGA-EE-A3AE-06 | exon_skip_470684 | 116414935 | 116415165 | 116414937 | 116414937 | Nonsense_Mutation | C | T | p.Q1011* |
| SKCM | TCGA-EE-A3AE-06 | exon_skip_470684 | 116414935 | 116415165 | 116414937 | 116414937 | Nonsense_Mutation | C | T | p.Q1011X |
| SKCM | TCGA-BF-A5EO-01 | exon_skip_470684 | 116414935 | 116415165 | 116414955 | 116414955 | Nonsense_Mutation | C | T | p.Q1017* |
| SKCM | TCGA-BF-A5EO-01 | exon_skip_470684 | 116414935 | 116415165 | 116414955 | 116414955 | Nonsense_Mutation | C | T | p.Q1017X |
| UCEC | TCGA-AP-A0LM-01 | exon_skip_470684 | 116414935 | 116415165 | 116414970 | 116414970 | Nonsense_Mutation | C | T | p.R1040* |
| COAD | TCGA-CA-6718-01 | exon_skip_470687 | 116418830 | 116419011 | 116418997 | 116418997 | Nonsense_Mutation | C | T | p.R1170X |
| READ | TCGA-F5-6814-01 | exon_skip_470687 | 116418830 | 116419011 | 116418997 | 116418997 | Nonsense_Mutation | C | T | p.R1170X |
| LUAD | TCGA-78-7143-01 | exon_skip_470683 | 116411903 | 116412043 | 116411902 | 116411902 | Splice_Site | G | A | p.D963_splice |
| LUAD | TCGA-50-6597-01 | exon_skip_470683 | 116411903 | 116412043 | 116412042 | 116412045 | Splice_Site | AGGT | - | p.D1010_splice |
| LUAD | TCGA-50-6597-01 | exon_skip_470683 | 116411903 | 116412043 | 116412042 | 116412045 | Splice_Site | AGGT | - | p.E1009_splice |
| LUAD | TCGA-49-6745-01 | exon_skip_470683 | 116411903 | 116412043 | 116412044 | 116412044 | Splice_Site | G | T | p.D1010_splice |
| LUAD | TCGA-93-7348-01 | exon_skip_470683 | 116411903 | 116412043 | 116412044 | 116412044 | Splice_Site | G | A | p.D1010_splice |
| LUAD | TCGA-75-5122-01 | exon_skip_470683 | 116411903 | 116412043 | 116412045 | 116412045 | Splice_Site | T | C | p.D1010_splice |
| STAD | TCGA-BR-6566-01 | exon_skip_470690 | 116423358 | 116423523 | 116423356 | 116423356 | Splice_Site | A | G | . |
| STAD | TCGA-BR-6566-01 | exon_skip_470690 | 116423358 | 116423523 | 116423356 | 116423356 | Splice_Site | A | G | p.M1211_splice |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
 | Sample: TCGA-49-6745-01 |
| Cancer type: LUAD | |
| ESID: exon_skip_470683 | |
| Skipped exon start: 116411903 | |
| Skipped exon end: 116412043 | |
| Mutation start: 116412044 | |
| Mutation end: 116412044 | |
| Mutation type: Splice_Site | |
| Reference seq: G | |
| Mutation seq: T | |
| AAchange: p.D1010_splice | |
exon_skip_460899_LUAD_TCGA-49-6745-01.png | |
exon_skip_470683_LUAD_TCGA-49-6745-01.png | |
 | Sample: TCGA-75-5122-01 |
| Cancer type: LUAD | |
| ESID: exon_skip_470683 | |
| Skipped exon start: 116411903 | |
| Skipped exon end: 116412043 | |
| Mutation start: 116412045 | |
| Mutation end: 116412045 | |
| Mutation type: Splice_Site | |
| Reference seq: T | |
| Mutation seq: C | |
| AAchange: p.D1010_splice | |
exon_skip_470683_LUAD_TCGA-75-5122-01.png | |
 | Sample: TCGA-78-7143-01 |
| Cancer type: LUAD | |
| ESID: exon_skip_470683 | |
| Skipped exon start: 116411903 | |
| Skipped exon end: 116412043 | |
| Mutation start: 116411902 | |
| Mutation end: 116411902 | |
| Mutation type: Splice_Site | |
| Reference seq: G | |
| Mutation seq: A | |
| AAchange: p.D963_splice | |
exon_skip_470683_LUAD_TCGA-78-7143-01.png | |
 | Sample: TCGA-93-7348-01 |
| Cancer type: LUAD | |
| ESID: exon_skip_470683 | |
| Skipped exon start: 116411903 | |
| Skipped exon end: 116412043 | |
| Mutation start: 116412044 | |
| Mutation end: 116412044 | |
| Mutation type: Splice_Site | |
| Reference seq: G | |
| Mutation seq: A | |
| AAchange: p.D1010_splice | |
exon_skip_470683_LUAD_TCGA-93-7348-01.png | |
 | Sample: TCGA-75-6205-01 |
| Cancer type: LUAD | |
| ESID: exon_skip_470683 | |
| Skipped exon start: 116411903 | |
| Skipped exon end: 116412043 | |
| Mutation start: 116412024 | |
| Mutation end: 116412024 | |
| Mutation type: Nonsense_Mutation | |
| Reference seq: C | |
| Mutation seq: G | |
| AAchange: p.Y1003* | |
exon_skip_470683_LUAD_TCGA-75-6205-01.png | |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| MHHPREB1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 116339125 | 116340338 | 116339820 | 116339820 | Frame_Shift_Del | T | - | p.F228fs |
| HCT116_LARGE_INTESTINE | 116339125 | 116340338 | 116339848 | 116339848 | Frame_Shift_Del | T | - | p.V237fs |
| MKN74_STOMACH | 116371722 | 116371913 | 116371887 | 116371887 | Frame_Shift_Del | G | - | p.G456fs |
| NCIH1838_LUNG | 116339125 | 116340338 | 116339175 | 116339175 | Missense_Mutation | G | T | p.V13L |
| RPMI7951_SKIN | 116339125 | 116340338 | 116339188 | 116339188 | Missense_Mutation | C | T | p.T17I |
| LS513_LARGE_INTESTINE | 116339125 | 116340338 | 116339238 | 116339238 | Missense_Mutation | G | A | p.E34K |
| HCC1588_LUNG | 116339125 | 116340338 | 116339238 | 116339238 | Missense_Mutation | G | A | p.E34K |
| KARPAS45_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 116339125 | 116340338 | 116339280 | 116339280 | Missense_Mutation | G | A | p.A48T |
| LS411N_LARGE_INTESTINE | 116339125 | 116340338 | 116339395 | 116339395 | Missense_Mutation | C | T | p.T86I |
| 201T_LUNG | 116339125 | 116340338 | 116339419 | 116339419 | Missense_Mutation | A | G | p.D94G |
| SNU1040_LARGE_INTESTINE | 116339125 | 116340338 | 116339503 | 116339503 | Missense_Mutation | T | A | p.V122D |
| MFE319_ENDOMETRIUM | 116339125 | 116340338 | 116339542 | 116339542 | Missense_Mutation | G | A | p.S135N |
| SNU719_STOMACH | 116339125 | 116340338 | 116339596 | 116339596 | Missense_Mutation | A | C | p.D153A |
| KARPAS45_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 116339125 | 116340338 | 116339608 | 116339608 | Missense_Mutation | A | G | p.E157G |
| JURKAT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 116339125 | 116340338 | 116339614 | 116339614 | Missense_Mutation | A | G | p.H159R |
| NCIH2342_LUNG | 116339125 | 116340338 | 116339640 | 116339640 | Missense_Mutation | G | A | p.E168K |
| BCP1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 116339125 | 116340338 | 116339655 | 116339655 | Missense_Mutation | C | G | p.P173A |
| SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 116339125 | 116340338 | 116339709 | 116339709 | Missense_Mutation | C | T | p.R191W |
| SUIT2_PANCREAS | 116339125 | 116340338 | 116339736 | 116339736 | Missense_Mutation | A | G | p.T200A |
| MM426_SKIN | 116339125 | 116340338 | 116339766 | 116339766 | Missense_Mutation | C | T | p.P210S |
| C3A_LIVER | 116339125 | 116340338 | 116339869 | 116339869 | Missense_Mutation | C | A | p.S244Y |
| NTERA2CLD1_TESTIS | 116339125 | 116340338 | 116339956 | 116339956 | Missense_Mutation | C | A | p.T273N |
| SW684_SOFT_TISSUE | 116339125 | 116340338 | 116340042 | 116340042 | Missense_Mutation | G | A | p.E302K |
| SNU81_LARGE_INTESTINE | 116339125 | 116340338 | 116340097 | 116340097 | Missense_Mutation | C | T | p.A320V |
| COLO201_LARGE_INTESTINE | 116339125 | 116340338 | 116340135 | 116340135 | Missense_Mutation | A | T | p.I333L |
| COLO205_LARGE_INTESTINE | 116339125 | 116340338 | 116340135 | 116340135 | Missense_Mutation | A | T | p.I333L |
| AN3CA_ENDOMETRIUM | 116339125 | 116340338 | 116340168 | 116340168 | Missense_Mutation | G | A | p.G344R |
| SF8657_SKIN | 116339125 | 116340338 | 116340201 | 116340201 | Missense_Mutation | G | A | p.E355K |
| MEWO_SKIN | 116339125 | 116340338 | 116340234 | 116340234 | Missense_Mutation | C | T | p.P366S |
| HEC108_ENDOMETRIUM | 116339125 | 116340338 | 116340263 | 116340263 | Missense_Mutation | C | G | p.N375K |
| OVMIU_OVARY | 116339125 | 116340338 | 116340263 | 116340263 | Missense_Mutation | C | G | p.N375K |
| TE8_OESOPHAGUS | 116339125 | 116340338 | 116340263 | 116340263 | Missense_Mutation | C | G | p.N375K |
| OUMS27_BONE | 116339125 | 116340338 | 116340270 | 116340270 | Missense_Mutation | G | A | p.V378I |
| HT115_LARGE_INTESTINE | 116371722 | 116371913 | 116371884 | 116371884 | Missense_Mutation | C | A | p.L455I |
| RH28_SOFT_TISSUE | 116395409 | 116395569 | 116395448 | 116395448 | Missense_Mutation | C | A | p.L581M |
| CORL321_PLEURA | 116395409 | 116395569 | 116395456 | 116395456 | Missense_Mutation | A | G | p.I583M |
| TE15_OESOPHAGUS | 116395409 | 116395569 | 116395491 | 116395491 | Missense_Mutation | A | C | p.K595T |
| BECKER_CENTRAL_NERVOUS_SYSTEM | 116395409 | 116395569 | 116395517 | 116395517 | Missense_Mutation | C | G | p.L604V |
| CHL1_SKIN | 116399391 | 116399544 | 116399407 | 116399407 | Missense_Mutation | C | T | p.P761S |
| HMCB_SKIN | 116399391 | 116399544 | 116399407 | 116399407 | Missense_Mutation | C | T | p.P761S |
| NCIH1869_LUNG | 116411903 | 116412043 | 116411927 | 116411927 | Missense_Mutation | A | G | p.Y989C |
| OE33_OESOPHAGUS | 116411903 | 116412043 | 116411980 | 116411980 | Missense_Mutation | G | A | p.V1007I |
| ECC12_STOMACH | 116411903 | 116412043 | 116411986 | 116411986 | Missense_Mutation | C | T | p.P1009S |
| EWS834_BONE | 116414935 | 116415165 | 116415127 | 116415127 | Missense_Mutation | G | A | p.S1092N |
| HCC15_LUNG | 116418830 | 116419011 | 116418907 | 116418907 | Missense_Mutation | C | T | p.L1158F |
| SNUC5_LARGE_INTESTINE | 116418830 | 116419011 | 116418911 | 116418911 | Missense_Mutation | C | T | p.S1159L |
| JHUEM7_ENDOMETRIUM | 116418830 | 116419011 | 116418932 | 116418932 | Missense_Mutation | G | A | p.R1166Q |
| CAKI1_KIDNEY | 116423358 | 116423523 | 116423383 | 116423383 | Missense_Mutation | G | A | p.V1238I |
| KMM1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 116423358 | 116423523 | 116423389 | 116423389 | Missense_Mutation | G | A | p.D1240N |
| WSUNHL_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 116423358 | 116423523 | 116423449 | 116423449 | Missense_Mutation | G | A | p.G1260S |
| HGC27_STOMACH | 116411903 | 116412043 | 116411928 | 116411928 | Nonsense_Mutation | C | A | p.Y989* |
| SNUC2A_LARGE_INTESTINE | 116418830 | 116419011 | 116418931 | 116418931 | Nonsense_Mutation | C | T | p.R1166* |
| HEC1_ENDOMETRIUM | 116418830 | 116419011 | 116418931 | 116418931 | Nonsense_Mutation | C | T | p.R1166* |
| SNUC2B_LARGE_INTESTINE | 116418830 | 116419011 | 116418931 | 116418931 | Nonsense_Mutation | C | T | p.R1166* |
| HT115_LARGE_INTESTINE | 116418830 | 116419011 | 116418997 | 116418997 | Nonsense_Mutation | C | T | p.R1188* |
| 8305C_THYROID | 116371722 | 116371913 | 116371717 | 116371741 | Splice_Site | TCCAGACACTTCTGAGAAATTCATC | - | p.PDTSEKF401fs |
| NCIH1155_LUNG | 116423358 | 116423523 | 116423359 | 116423359 | Splice_Site | C | T | p.L1230L |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for MET |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for MET |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for MET |
Top |
RelatedDrugs for MET |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
| P08581 | DB08865 | Crizotinib | Hepatocyte growth factor receptor | small molecule | approved | |
| P08581 | DB08875 | Cabozantinib | Hepatocyte growth factor receptor | small molecule | approved|investigational | |
| P08581 | DB12010 | Fostamatinib | Hepatocyte growth factor receptor | small molecule | approved|investigational | |
| P08581 | DB12267 | Brigatinib | Hepatocyte growth factor receptor | small molecule | approved|investigational |
Top |
RelatedDiseases for MET |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| MET | C1336839 | Type 1 Papillary Renal Cell Carcinoma | 5 | UNIPROT |
| MET | C0007131 | Non-Small Cell Lung Carcinoma | 4 | CTD_human |
| MET | C0001418 | Adenocarcinoma | 2 | CTD_human |
| MET | C0004352 | Autistic Disorder | 2 | CTD_human |
| MET | C0027627 | Neoplasm Metastasis | 2 | CTD_human |
| MET | C0038356 | Stomach Neoplasms | 2 | CTD_human |
| MET | C0004114 | Astrocytoma | 1 | CTD_human |
| MET | C0007134 | Renal Cell Carcinoma | 1 | CTD_human |
| MET | C0007137 | Squamous cell carcinoma | 1 | CTD_human |
| MET | C0009241 | Cognition Disorders | 1 | CTD_human |
| MET | C0014859 | Esophageal Neoplasms | 1 | CTD_human |
| MET | C0017636 | Glioblastoma | 1 | CTD_human |
| MET | C0019189 | Hepatitis, Chronic | 1 | CTD_human |
| MET | C0023467 | Leukemia, Myelocytic, Acute | 1 | CTD_human |
| MET | C0023904 | Liver Neoplasms, Experimental | 1 | CTD_human |
| MET | C0024121 | Lung Neoplasms | 1 | CTD_human |
| MET | C0027626 | Neoplasm Invasiveness | 1 | CTD_human |
| MET | C0027819 | Neuroblastoma | 1 | CTD_human |
| MET | C0029463 | Osteosarcoma | 1 | CTD_human |
| MET | C0036341 | Schizophrenia | 1 | CTD_human |
| MET | C0037199 | Sinusitis | 1 | CTD_human |
| MET | C0345967 | Malignant mesothelioma | 1 | CTD_human |
| MET | C0919267 | ovarian neoplasm | 1 | CTD_human |
| MET | C1876165 | Copper-Overload Cirrhosis | 1 | CTD_human |
| MET | C2239176 | Liver carcinoma | 1 | CTD_human;HPO;UNIPROT |
| MET | C4084709 | DEAFNESS, AUTOSOMAL RECESSIVE 97 | 1 | UNIPROT |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|