|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for ARHGAP6 |
 Gene summary |
| Gene information | Gene symbol | ARHGAP6 | Gene ID | 395 |
| Gene name | Rho GTPase activating protein 6 | |
| Synonyms | RHOGAP6|RHOGAPX-1 | |
| Cytomap | Xp22.2 | |
| Type of gene | protein-coding | |
| Description | rho GTPase-activating protein 6Rho-type GTPase-activating protein RhoGAPX-1rho-type GTPase-activating protein 6 | |
| Modification date | 20180519 | |
| UniProtAcc | O43182 | |
| Context | PubMed: ARHGAP6 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for ARHGAP6 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for ARHGAP6 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for ARHGAP6 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_513920 | X | 11160352:11160433:11162099:11162368:11174648:11174746 | 11162099:11162368 | ENSG00000047648.17 | ENST00000534860.1,ENST00000303025.6,ENST00000380736.1,ENST00000337414.4 |
| exon_skip_513924 | X | 11162133:11162368:11166749:11166839:11174648:11174746 | 11166749:11166839 | ENSG00000047648.17 | ENST00000495242.1,ENST00000413512.3 |
| exon_skip_513926 | X | 11196219:11196368:11197421:11197572:11200182:11200194 | 11197421:11197572 | ENSG00000047648.17 | ENST00000495242.1,ENST00000380732.3,ENST00000534860.1,ENST00000303025.6,ENST00000380736.1,ENST00000413512.3,ENST00000337414.4,ENST00000491514.1,ENST00000380717.3,ENST00000380718.1,ENST00000489330.2 |
| exon_skip_513927 | X | 11204355:11204551:11206847:11207104:11215044:11215116 | 11206847:11207104 | ENSG00000047648.17 | ENST00000495242.1,ENST00000380732.3,ENST00000534860.1,ENST00000303025.6,ENST00000380736.1,ENST00000413512.3,ENST00000337414.4,ENST00000380717.3,ENST00000380718.1,ENST00000489330.2 |
| exon_skip_513928 | X | 11215044:11215116:11272667:11272827:11445667:11445893 | 11272667:11272827 | ENSG00000047648.17 | ENST00000380736.1 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for ARHGAP6 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_513920 | X | 11160352:11160433:11162099:11162368:11174648:11174746 | 11162099:11162368 | ENSG00000047648.17 | ENST00000534860.1,ENST00000380736.1,ENST00000303025.6,ENST00000337414.4 |
| exon_skip_513921 | X | 11161273:11162365:11163191:11163241:11166749:11166839 | 11163191:11163241 | ENSG00000047648.17 | ENST00000489330.2 |
| exon_skip_513924 | X | 11162133:11162368:11166749:11166839:11174648:11174746 | 11166749:11166839 | ENSG00000047648.17 | ENST00000495242.1,ENST00000413512.3 |
| exon_skip_513926 | X | 11196219:11196368:11197421:11197572:11200182:11200194 | 11197421:11197572 | ENSG00000047648.17 | ENST00000534860.1,ENST00000380736.1,ENST00000303025.6,ENST00000337414.4,ENST00000495242.1,ENST00000489330.2,ENST00000380717.3,ENST00000380718.1,ENST00000413512.3,ENST00000380732.3,ENST00000491514.1 |
| exon_skip_513927 | X | 11204355:11204551:11206847:11207104:11215044:11215116 | 11206847:11207104 | ENSG00000047648.17 | ENST00000534860.1,ENST00000380736.1,ENST00000303025.6,ENST00000337414.4,ENST00000495242.1,ENST00000489330.2,ENST00000380717.3,ENST00000380718.1,ENST00000413512.3,ENST00000380732.3 |
| exon_skip_513928 | X | 11215044:11215116:11272667:11272827:11445667:11445893 | 11272667:11272827 | ENSG00000047648.17 | ENST00000380736.1 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for ARHGAP6 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000337414 | 11162099 | 11162368 | Frame-shift |
| ENST00000337414 | 11197421 | 11197572 | Frame-shift |
| ENST00000337414 | 11206847 | 11207104 | Frame-shift |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000337414 | 11162099 | 11162368 | Frame-shift |
| ENST00000337414 | 11197421 | 11197572 | Frame-shift |
| ENST00000337414 | 11206847 | 11207104 | Frame-shift |
Top |
Infer the effects of exon skipping event on protein functional features for ARHGAP6 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
Top |
SNVs in the skipped exons for ARHGAP6 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| STAD | TCGA-CG-4304-01 | 11162100 | 11162368 | 11162203 | 11162252 | Frame_Shift_Del | CCCCGGGGCCGCGTCCTCTTGCATAGCCAGCAGGGAGCGCTCAGACAGCA | - | p.675_692del | |
| SKCM | TCGA-EE-A3AF-06 | 11162100 | 11162368 | 11162261 | 11162288 | Frame_Shift_Del | TTGTTGTCATAAGGGGAGATGTCTCCGC | - | p.SGDISPYDNN663fs | |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_513927 | 11206848 | 11207104 | 11207018 | 11207018 | Frame_Shift_Del | C | - | p.D303fs |
| KIRC | TCGA-A3-3346-01 | 11162100 | 11162368 | 11162200 | 11162201 | Frame_Shift_Ins | - | C | p.V692fs | |
| STAD | TCGA-HU-A4HD-01 | 11162100 | 11162368 | 11162141 | 11162141 | Nonsense_Mutation | G | C | p.S712* | |
| STAD | TCGA-HU-A4HD-01 | 11162100 | 11162368 | 11162141 | 11162141 | Nonsense_Mutation | G | C | p.S712X | |
| BLCA | TCGA-FD-A6TC-01 | exon_skip_513927 | 11206848 | 11207104 | 11206912 | 11206912 | Nonsense_Mutation | G | C | p.S338* |
| ESCA | TCGA-VR-A8Q7-01 | exon_skip_513927 | 11206848 | 11207104 | 11206970 | 11206970 | Nonsense_Mutation | C | A | p.G319* |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| KM12_LARGE_INTESTINE | 11162100 | 11162368 | 11162200 | 11162201 | Frame_Shift_Ins | - | C | p.G692fs |
| RS411_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 11162100 | 11162368 | 11162192 | 11162192 | Missense_Mutation | T | G | p.K695T |
| SNU1040_LARGE_INTESTINE | 11162100 | 11162368 | 11162224 | 11162224 | Missense_Mutation | C | T | p.M684I |
| SNU407_LARGE_INTESTINE | 11162100 | 11162368 | 11162242 | 11162242 | Missense_Mutation | C | A | p.E678D |
| EPLC272H_LUNG | 11162100 | 11162368 | 11162247 | 11162247 | Missense_Mutation | A | G | p.S677P |
| CHLA218_BONE | 11162100 | 11162368 | 11162268 | 11162268 | Missense_Mutation | C | A | p.D670Y |
| MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 11162100 | 11162368 | 11162312 | 11162312 | Missense_Mutation | G | C | p.S655C |
| OVK18_OVARY | 11197422 | 11197572 | 11197521 | 11197521 | Missense_Mutation | T | C | p.S461G |
| MFE319_ENDOMETRIUM | 11206848 | 11207104 | 11206892 | 11206892 | Missense_Mutation | T | C | p.T345A |
| CW2_LARGE_INTESTINE | 11162100 | 11162368 | 11162328 | 11162328 | Nonsense_Mutation | C | A | p.G650* |
| TK10_KIDNEY | 11206848 | 11207104 | 11207084 | 11207084 | Nonsense_Mutation | C | A | p.G281* |
| NCIH211_LUNG | 11272668 | 11272827 | 11272710 | 11272710 | Nonsense_Mutation | G | A | p.Q236* |
| J82_URINARY_TRACT | 11272668 | 11272827 | 11272755 | 11272755 | Nonsense_Mutation | C | A | p.E221* |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for ARHGAP6 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for ARHGAP6 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for ARHGAP6 |
Top |
RelatedDrugs for ARHGAP6 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for ARHGAP6 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|