|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for ITIH2 |
 Gene summary |
| Gene information | Gene symbol | ITIH2 | Gene ID | 3698 |
| Gene name | inter-alpha-trypsin inhibitor heavy chain 2 | |
| Synonyms | H2P|SHAP | |
| Cytomap | 10p14 | |
| Type of gene | protein-coding | |
| Description | inter-alpha-trypsin inhibitor heavy chain H2ITI heavy chain H2ITI-HC2inter-alpha (globulin) inhibitor H2inter-alpha (globulin) inhibitor, H2 polypeptideinter-alpha-inhibitor heavy chain 2inter-alpha-trypsin inhibitor complex component IIserum-deriv | |
| Modification date | 20180519 | |
| UniProtAcc | P19823 | |
| Context | PubMed: ITIH2 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for ITIH2 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for ITIH2 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for ITIH2 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_39471 | 10 | 7745362:7745481:7747070:7747145:7749163:7749196 | 7747070:7747145 | ENSG00000151655.13 | ENST00000473227.1,ENST00000480387.1 |
| exon_skip_39472 | 10 | 7745362:7745481:7747070:7747145:7750984:7751154 | 7747070:7747145 | ENSG00000151655.13 | ENST00000379587.4 |
| exon_skip_39473 | 10 | 7745362:7745481:7749163:7749196:7750984:7751154 | 7749163:7749196 | ENSG00000151655.13 | ENST00000429820.1 |
| exon_skip_39476 | 10 | 7747070:7747145:7749163:7749196:7750984:7751154 | 7749163:7749196 | ENSG00000151655.13 | ENST00000473227.1,ENST00000358415.4 |
| exon_skip_39479 | 10 | 7749163:7749196:7750984:7751154:7755143:7755226 | 7750984:7751154 | ENSG00000151655.13 | ENST00000429820.1,ENST00000473227.1,ENST00000358415.4 |
| exon_skip_39481 | 10 | 7750984:7751154:7755143:7755248:7759588:7759751 | 7755143:7755248 | ENSG00000151655.13 | ENST00000429820.1,ENST00000379587.4,ENST00000358415.4 |
| exon_skip_39482 | 10 | 7759588:7759751:7762818:7762926:7763611:7763660 | 7762818:7762926 | ENSG00000151655.13 | ENST00000429820.1,ENST00000379587.4,ENST00000358415.4 |
| exon_skip_39485 | 10 | 7762818:7762926:7763611:7763740:7765413:7765530 | 7763611:7763740 | ENSG00000151655.13 | ENST00000379587.4,ENST00000358415.4 |
| exon_skip_39486 | 10 | 7768912:7769081:7769665:7769791:7771914:7772096 | 7769665:7769791 | ENSG00000151655.13 | ENST00000379587.4,ENST00000358415.4 |
| exon_skip_39488 | 10 | 7771914:7772096:7773773:7773959:7774300:7774436 | 7773773:7773959 | ENSG00000151655.13 | ENST00000379587.4,ENST00000477751.1,ENST00000358415.4 |
| exon_skip_39489 | 10 | 7774300:7774440:7776884:7777054:7780583:7780721 | 7776884:7777054 | ENSG00000151655.13 | ENST00000379587.4,ENST00000358415.4 |
| exon_skip_39491 | 10 | 7776887:7777054:7780583:7780721:7785108:7785222 | 7780583:7780721 | ENSG00000151655.13 | ENST00000379587.4,ENST00000358415.4 |
| exon_skip_39493 | 10 | 7780583:7780721:7785108:7785222:7786044:7786243 | 7785108:7785222 | ENSG00000151655.13 | ENST00000379587.4,ENST00000358415.4 |
| exon_skip_39497 | 10 | 7785108:7785222:7786044:7786243:7786753:7786926 | 7786044:7786243 | ENSG00000151655.13 | ENST00000379587.4,ENST00000358415.4 |
| exon_skip_39501 | 10 | 7786753:7786926:7788555:7788667:7791149:7791302 | 7788555:7788667 | ENSG00000151655.13 | ENST00000379587.4,ENST00000358415.4 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for ITIH2 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_39471 | 10 | 7745362:7745481:7747070:7747145:7749163:7749196 | 7747070:7747145 | ENSG00000151655.13 | ENST00000473227.1,ENST00000480387.1 |
| exon_skip_39476 | 10 | 7747070:7747145:7749163:7749196:7750984:7751154 | 7749163:7749196 | ENSG00000151655.13 | ENST00000358415.4,ENST00000473227.1 |
| exon_skip_39481 | 10 | 7750984:7751154:7755143:7755248:7759588:7759751 | 7755143:7755248 | ENSG00000151655.13 | ENST00000358415.4,ENST00000429820.1,ENST00000379587.4 |
| exon_skip_39482 | 10 | 7759588:7759751:7762818:7762926:7763611:7763660 | 7762818:7762926 | ENSG00000151655.13 | ENST00000358415.4,ENST00000429820.1,ENST00000379587.4 |
| exon_skip_39488 | 10 | 7771914:7772096:7773773:7773959:7774300:7774436 | 7773773:7773959 | ENSG00000151655.13 | ENST00000358415.4,ENST00000379587.4,ENST00000477751.1 |
| exon_skip_39489 | 10 | 7774300:7774440:7776884:7777054:7780583:7780721 | 7776884:7777054 | ENSG00000151655.13 | ENST00000358415.4,ENST00000379587.4 |
| exon_skip_39491 | 10 | 7776887:7777054:7780583:7780721:7785108:7785222 | 7780583:7780721 | ENSG00000151655.13 | ENST00000358415.4,ENST00000379587.4 |
| exon_skip_39493 | 10 | 7780583:7780721:7785108:7785222:7786044:7786243 | 7785108:7785222 | ENSG00000151655.13 | ENST00000358415.4,ENST00000379587.4 |
| exon_skip_39497 | 10 | 7785108:7785222:7786044:7786243:7786753:7786926 | 7786044:7786243 | ENSG00000151655.13 | ENST00000358415.4,ENST00000379587.4 |
| exon_skip_39501 | 10 | 7786753:7786926:7788555:7788667:7791149:7791302 | 7788555:7788667 | ENSG00000151655.13 | ENST00000358415.4,ENST00000379587.4 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for ITIH2 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000358415 | 7750984 | 7751154 | Frame-shift |
| ENST00000358415 | 7776884 | 7777054 | Frame-shift |
| ENST00000358415 | 7786044 | 7786243 | Frame-shift |
| ENST00000358415 | 7788555 | 7788667 | Frame-shift |
| ENST00000358415 | 7749163 | 7749196 | In-frame |
| ENST00000358415 | 7755143 | 7755248 | In-frame |
| ENST00000358415 | 7762818 | 7762926 | In-frame |
| ENST00000358415 | 7763611 | 7763740 | In-frame |
| ENST00000358415 | 7769665 | 7769791 | In-frame |
| ENST00000358415 | 7773773 | 7773959 | In-frame |
| ENST00000358415 | 7780583 | 7780721 | In-frame |
| ENST00000358415 | 7785108 | 7785222 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000358415 | 7776884 | 7777054 | Frame-shift |
| ENST00000358415 | 7786044 | 7786243 | Frame-shift |
| ENST00000358415 | 7788555 | 7788667 | Frame-shift |
| ENST00000358415 | 7749163 | 7749196 | In-frame |
| ENST00000358415 | 7755143 | 7755248 | In-frame |
| ENST00000358415 | 7762818 | 7762926 | In-frame |
| ENST00000358415 | 7773773 | 7773959 | In-frame |
| ENST00000358415 | 7780583 | 7780721 | In-frame |
| ENST00000358415 | 7785108 | 7785222 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for ITIH2 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000358415 | 3210 | 946 | 7749163 | 7749196 | 326 | 358 | 53 | 64 |
| ENST00000358415 | 3210 | 946 | 7755143 | 7755248 | 529 | 633 | 121 | 155 |
| ENST00000358415 | 3210 | 946 | 7762818 | 7762926 | 797 | 904 | 210 | 246 |
| ENST00000358415 | 3210 | 946 | 7763611 | 7763740 | 905 | 1033 | 246 | 289 |
| ENST00000358415 | 3210 | 946 | 7769665 | 7769791 | 1320 | 1445 | 384 | 426 |
| ENST00000358415 | 3210 | 946 | 7773773 | 7773959 | 1628 | 1813 | 487 | 549 |
| ENST00000358415 | 3210 | 946 | 7780583 | 7780721 | 2124 | 2261 | 652 | 698 |
| ENST00000358415 | 3210 | 946 | 7785108 | 7785222 | 2262 | 2375 | 698 | 736 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000358415 | 3210 | 946 | 7749163 | 7749196 | 326 | 358 | 53 | 64 |
| ENST00000358415 | 3210 | 946 | 7755143 | 7755248 | 529 | 633 | 121 | 155 |
| ENST00000358415 | 3210 | 946 | 7762818 | 7762926 | 797 | 904 | 210 | 246 |
| ENST00000358415 | 3210 | 946 | 7773773 | 7773959 | 1628 | 1813 | 487 | 549 |
| ENST00000358415 | 3210 | 946 | 7780583 | 7780721 | 2124 | 2261 | 652 | 698 |
| ENST00000358415 | 3210 | 946 | 7785108 | 7785222 | 2262 | 2375 | 698 | 736 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| P19823 | 53 | 64 | 55 | 702 | Chain | ID=PRO_0000016518;Note=Inter-alpha-trypsin inhibitor heavy chain H2 |
| P19823 | 53 | 64 | 56 | 185 | Domain | Note=VIT;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00801 |
| P19823 | 53 | 64 | 60 | 60 | Modified residue | Note=Phosphoserine%3B by FAM20C;Ontology_term=ECO:0000244,ECO:0000269;evidence=ECO:0000244|PubMed:24275569,ECO:0000269|PubMed:26091039;Dbxref=PMID:24275569,PMID:26091039 |
| P19823 | 53 | 64 | 19 | 54 | Propeptide | ID=PRO_0000016517 |
| P19823 | 121 | 155 | 55 | 702 | Chain | ID=PRO_0000016518;Note=Inter-alpha-trypsin inhibitor heavy chain H2 |
| P19823 | 121 | 155 | 56 | 185 | Domain | Note=VIT;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00801 |
| P19823 | 210 | 246 | 55 | 702 | Chain | ID=PRO_0000016518;Note=Inter-alpha-trypsin inhibitor heavy chain H2 |
| P19823 | 246 | 289 | 55 | 702 | Chain | ID=PRO_0000016518;Note=Inter-alpha-trypsin inhibitor heavy chain H2 |
| P19823 | 246 | 289 | 261 | 264 | Disulfide bond | Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:9425062;Dbxref=PMID:9425062 |
| P19823 | 246 | 289 | 282 | 282 | Modified residue | Note=4-carboxyglutamate;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:2450046;Dbxref=PMID:2450046 |
| P19823 | 246 | 289 | 283 | 283 | Modified residue | Note=4-carboxyglutamate;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:2450046;Dbxref=PMID:2450046 |
| P19823 | 246 | 289 | 263 | 263 | Natural variant | ID=VAR_055248;Note=N->S;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:2450046;Dbxref=dbSNP:rs7075296,PMID:2450046 |
| P19823 | 384 | 426 | 55 | 702 | Chain | ID=PRO_0000016518;Note=Inter-alpha-trypsin inhibitor heavy chain H2 |
| P19823 | 384 | 426 | 308 | 468 | Domain | Note=VWFA;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00219 |
| P19823 | 487 | 549 | 55 | 702 | Chain | ID=PRO_0000016518;Note=Inter-alpha-trypsin inhibitor heavy chain H2 |
| P19823 | 652 | 698 | 55 | 702 | Chain | ID=PRO_0000016518;Note=Inter-alpha-trypsin inhibitor heavy chain H2 |
| P19823 | 652 | 698 | 666 | 666 | Glycosylation | ID=CAR_000214;Note=O-linked (GalNAc...) threonine%3B partial;Ontology_term=ECO:0000269,ECO:0000269;evidence=ECO:0000269|PubMed:9425062,ECO:0000269|PubMed:9677337;Dbxref=PMID:9425062,PMID:9677337 |
| P19823 | 652 | 698 | 673 | 673 | Glycosylation | ID=CAR_000215;Note=O-linked (GalNAc...) serine;Ontology_term=ECO:0000269,ECO:0000269;evidence=ECO:0000269|PubMed:9425062,ECO:0000269|PubMed:9677337;Dbxref=PMID:9425062,PMID:9677337 |
| P19823 | 652 | 698 | 675 | 675 | Glycosylation | ID=CAR_000216;Note=O-linked (GalNAc...) threonine;Ontology_term=ECO:0000269,ECO:0000269;evidence=ECO:0000269|PubMed:9425062,ECO:0000269|PubMed:9677337;Dbxref=PMID:9425062,PMID:9677337 |
| P19823 | 652 | 698 | 691 | 691 | Glycosylation | ID=CAR_000217;Note=O-linked (GalNAc...) threonine;Ontology_term=ECO:0000269,ECO:0000269,ECO:0000269;evidence=ECO:0000269|PubMed:7682553,ECO:0000269|PubMed:9425062,ECO:0000269|PubMed:9677337;Dbxref=PMID:7682553,PMID:9425062,PMID:9677337 |
| P19823 | 652 | 698 | 674 | 674 | Natural variant | ID=VAR_055250;Note=P->A;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:2462430;Dbxref=dbSNP:rs3740217,PMID:2462430 |
| P19823 | 652 | 698 | 665 | 679 | Region | Note=O-glycosylated at three sites |
| P19823 | 698 | 736 | 55 | 702 | Chain | ID=PRO_0000016518;Note=Inter-alpha-trypsin inhibitor heavy chain H2 |
| P19823 | 698 | 736 | 702 | 702 | Modified residue | Note=Aspartate 1-(chondroitin 4-sulfate)-ester |
| P19823 | 698 | 736 | 703 | 946 | Propeptide | ID=PRO_0000016519 |
| P19823 | 698 | 736 | 705 | 705 | Sequence conflict | Note=F->S;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| P19823 | 698 | 736 | 705 | 705 | Sequence conflict | Note=F->S;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| P19823 | 698 | 736 | 729 | 729 | Sequence conflict | Note=N->D;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| P19823 | 698 | 736 | 729 | 729 | Sequence conflict | Note=N->D;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| P19823 | 698 | 736 | 731 | 731 | Sequence conflict | Note=V->A;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| P19823 | 698 | 736 | 731 | 731 | Sequence conflict | Note=V->A;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| P19823 | 53 | 64 | 55 | 702 | Chain | ID=PRO_0000016518;Note=Inter-alpha-trypsin inhibitor heavy chain H2 |
| P19823 | 53 | 64 | 56 | 185 | Domain | Note=VIT;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00801 |
| P19823 | 53 | 64 | 60 | 60 | Modified residue | Note=Phosphoserine%3B by FAM20C;Ontology_term=ECO:0000244,ECO:0000269;evidence=ECO:0000244|PubMed:24275569,ECO:0000269|PubMed:26091039;Dbxref=PMID:24275569,PMID:26091039 |
| P19823 | 53 | 64 | 19 | 54 | Propeptide | ID=PRO_0000016517 |
| P19823 | 121 | 155 | 55 | 702 | Chain | ID=PRO_0000016518;Note=Inter-alpha-trypsin inhibitor heavy chain H2 |
| P19823 | 121 | 155 | 56 | 185 | Domain | Note=VIT;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00801 |
| P19823 | 210 | 246 | 55 | 702 | Chain | ID=PRO_0000016518;Note=Inter-alpha-trypsin inhibitor heavy chain H2 |
| P19823 | 487 | 549 | 55 | 702 | Chain | ID=PRO_0000016518;Note=Inter-alpha-trypsin inhibitor heavy chain H2 |
| P19823 | 652 | 698 | 55 | 702 | Chain | ID=PRO_0000016518;Note=Inter-alpha-trypsin inhibitor heavy chain H2 |
| P19823 | 652 | 698 | 666 | 666 | Glycosylation | ID=CAR_000214;Note=O-linked (GalNAc...) threonine%3B partial;Ontology_term=ECO:0000269,ECO:0000269;evidence=ECO:0000269|PubMed:9425062,ECO:0000269|PubMed:9677337;Dbxref=PMID:9425062,PMID:9677337 |
| P19823 | 652 | 698 | 673 | 673 | Glycosylation | ID=CAR_000215;Note=O-linked (GalNAc...) serine;Ontology_term=ECO:0000269,ECO:0000269;evidence=ECO:0000269|PubMed:9425062,ECO:0000269|PubMed:9677337;Dbxref=PMID:9425062,PMID:9677337 |
| P19823 | 652 | 698 | 675 | 675 | Glycosylation | ID=CAR_000216;Note=O-linked (GalNAc...) threonine;Ontology_term=ECO:0000269,ECO:0000269;evidence=ECO:0000269|PubMed:9425062,ECO:0000269|PubMed:9677337;Dbxref=PMID:9425062,PMID:9677337 |
| P19823 | 652 | 698 | 691 | 691 | Glycosylation | ID=CAR_000217;Note=O-linked (GalNAc...) threonine;Ontology_term=ECO:0000269,ECO:0000269,ECO:0000269;evidence=ECO:0000269|PubMed:7682553,ECO:0000269|PubMed:9425062,ECO:0000269|PubMed:9677337;Dbxref=PMID:7682553,PMID:9425062,PMID:9677337 |
| P19823 | 652 | 698 | 674 | 674 | Natural variant | ID=VAR_055250;Note=P->A;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:2462430;Dbxref=dbSNP:rs3740217,PMID:2462430 |
| P19823 | 652 | 698 | 665 | 679 | Region | Note=O-glycosylated at three sites |
| P19823 | 698 | 736 | 55 | 702 | Chain | ID=PRO_0000016518;Note=Inter-alpha-trypsin inhibitor heavy chain H2 |
| P19823 | 698 | 736 | 702 | 702 | Modified residue | Note=Aspartate 1-(chondroitin 4-sulfate)-ester |
| P19823 | 698 | 736 | 703 | 946 | Propeptide | ID=PRO_0000016519 |
| P19823 | 698 | 736 | 705 | 705 | Sequence conflict | Note=F->S;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| P19823 | 698 | 736 | 705 | 705 | Sequence conflict | Note=F->S;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| P19823 | 698 | 736 | 729 | 729 | Sequence conflict | Note=N->D;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| P19823 | 698 | 736 | 729 | 729 | Sequence conflict | Note=N->D;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| P19823 | 698 | 736 | 731 | 731 | Sequence conflict | Note=V->A;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| P19823 | 698 | 736 | 731 | 731 | Sequence conflict | Note=V->A;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
Top |
SNVs in the skipped exons for ITIH2 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
ITIH2_LIHC_exon_skip_39479_psi_boxplot.png |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_39479 | 7750985 | 7751154 | 7751085 | 7751085 | Frame_Shift_Del | C | - | p.S98fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_39485 | 7763612 | 7763740 | 7763684 | 7763684 | Frame_Shift_Del | G | - | p.G271fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_39485 | 7763612 | 7763740 | 7763711 | 7763711 | Frame_Shift_Del | A | - | p.K280fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_39485 | 7763612 | 7763740 | 7763729 | 7763729 | Frame_Shift_Del | G | - | p.G286fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_39486 | 7769666 | 7769791 | 7769705 | 7769705 | Frame_Shift_Del | T | - | p.I398fs |
| LIHC | TCGA-BC-A10U-01 | exon_skip_39488 | 7773774 | 7773959 | 7773850 | 7773850 | Frame_Shift_Del | T | - | p.V513fs |
| LUAD | TCGA-86-8674-01 | exon_skip_39489 | 7776885 | 7777054 | 7776943 | 7776965 | Frame_Shift_Del | TCTCTAGACCACCACATTGTGAC | - | p.SLDHHIVT616fs |
| ESCA | TCGA-L5-A88W-01 | exon_skip_39491 | 7780584 | 7780721 | 7780587 | 7780587 | Frame_Shift_Del | C | - | p.A654fs |
| ESCA | TCGA-L5-A88W-01 | exon_skip_39491 | 7780584 | 7780721 | 7780587 | 7780587 | Frame_Shift_Del | C | - | p.L655fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_39493 | 7785109 | 7785222 | 7785125 | 7785125 | Frame_Shift_Del | T | - | p.H704fs |
| KIRC | TCGA-B8-5162-01 | exon_skip_39497 | 7786045 | 7786243 | 7786219 | 7786220 | Frame_Shift_Del | AC | - | p.D795fs |
| UCEC | TCGA-BG-A0MQ-01 | exon_skip_39486 | 7769666 | 7769791 | 7769789 | 7769790 | Frame_Shift_Ins | - | GGGC | p.E428fs |
| UCEC | TCGA-BG-A0MQ-01 | exon_skip_39486 | 7769666 | 7769791 | 7769789 | 7769790 | Frame_Shift_Ins | - | GGGC | p.V426fs |
| UCEC | TCGA-B5-A0JY-01 | exon_skip_39471 exon_skip_39472 | 7747071 | 7747145 | 7747143 | 7747143 | Nonsense_Mutation | C | T | p.Q53* |
| SKCM | TCGA-EE-A181-06 | exon_skip_39479 | 7750985 | 7751154 | 7750997 | 7750997 | Nonsense_Mutation | C | T | p.Q69* |
| LUAD | TCGA-55-A490-01 | exon_skip_39481 | 7755144 | 7755248 | 7755207 | 7755207 | Nonsense_Mutation | T | G | p.Y142* |
| SKCM | TCGA-ER-A19P-06 | exon_skip_39486 | 7769666 | 7769791 | 7769728 | 7769728 | Nonsense_Mutation | G | T | p.G406* |
| UCEC | TCGA-BG-A0LX-01 | exon_skip_39491 | 7780584 | 7780721 | 7780691 | 7780691 | Nonsense_Mutation | G | T | p.E689* |
| UCEC | TCGA-A5-A0G5-01 | exon_skip_39488 | 7773774 | 7773959 | 7773961 | 7773961 | Splice_Site | T | A | e13+2 |
| UCEC | TCGA-A5-A0G5-01 | exon_skip_39488 | 7773774 | 7773959 | 7773961 | 7773961 | Splice_Site | T | A | p.S549_splice |
| STAD | TCGA-BR-8680-01 | exon_skip_39493 | 7785109 | 7785222 | 7785224 | 7785224 | Splice_Site | T | C | . |
| STAD | TCGA-BR-8680-01 | exon_skip_39493 | 7785109 | 7785222 | 7785224 | 7785224 | Splice_Site | T | C | p.G737_splice |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
 | Sample: TCGA-DD-A39Y-01 |
| Cancer type: LIHC | |
| ESID: exon_skip_39479 | |
| Skipped exon start: 7750985 | |
| Skipped exon end: 7751154 | |
| Mutation start: 7751085 | |
| Mutation end: 7751085 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: C | |
| Mutation seq: - | |
| AAchange: p.S98fs | |
exon_skip_105023_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_101824_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_106032_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_106378_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_106523_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_106524_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_109527_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_109529_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_110000_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_11029_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_111893_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_111894_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_112042_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_112647_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_114045_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_114046_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_114565_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_11916_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_1234_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_1237_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_124639_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_124693_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_124695_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_130535_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_13071_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_131505_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_133556_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_135211_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_135545_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_135553_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_135763_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_137564_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_138947_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_139222_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_141370_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_141945_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_143515_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_143728_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_14772_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_148319_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_148332_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_14897_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_150985_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_151979_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_153387_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_153494_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_153786_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_155021_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_155962_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_155964_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_19897_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_19898_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_19902_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_20050_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_20053_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_21823_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_22411_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_22908_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_23470_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_24870_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_25336_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_26316_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_26461_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_26958_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_27038_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_27415_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_283977_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_284046_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_289275_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_291046_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_291218_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_291361_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_292293_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_292562_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_293040_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_293045_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_293052_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_293118_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_293546_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_293549_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_294064_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_294067_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_29565_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_29733_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_299242_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_299287_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_299304_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_299306_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_299307_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_30001_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_300924_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_301267_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_301272_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_302090_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_302094_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_302095_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_302097_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_3064_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_306549_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_30744_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_309425_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_310969_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_311352_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_313264_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_313342_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_313654_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_315571_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_315574_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_316800_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_316803_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_31730_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_317832_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_319816_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_320714_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_320715_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_320801LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_320805_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_321225_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_323910_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_32899_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_329221_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_331329_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_331444_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_332241_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_334248_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_335284_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_337247_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_34018_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_340419_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_34444_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_34446_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_346508_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_346721_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_346953_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_350661_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_352716_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_35400_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_354396_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_359435_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_360259_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_360261_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_360316_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_361235_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_364697_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_365330_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_369483_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_369915_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_371550_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_371589_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_374387_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_374402_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_37475_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_37491_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_374945_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_375131_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_375133_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_375393_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_376191_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_378801_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_379758_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_379855_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_380880_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_3815_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_382091_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_382119_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_382121_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_382417_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_382738_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_383797_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_383994_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_385335_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_387812_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_387826_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_389735_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_39262_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_39479_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_39686_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_422548_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_423337_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_423570_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_424308_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_426528_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_426530_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_427280_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_430528_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_433655_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_434375_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_435237_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_435489_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_436454_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_436487_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_436488_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_436494_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_437675_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_437849_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_439418_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_440194_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_440267_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_441705_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_442657_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_443695_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_444190_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_445458_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_446492_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_446495_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_446671_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_450412_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_450419_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_453010_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_454760_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_456871_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_458039_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_458091_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_45824_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_458292_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_458727_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_459683_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_460515_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_463936_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_464994_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_465641_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_469364_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_470206_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_470208_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_470470_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_470485_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_471015_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_471018_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_471458_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_472524_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_472955_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_475132_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_47552_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_476535_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_477211_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_477637_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_478117_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_47838_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_478401_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_478926_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_483792_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_487634_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_489575_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_490603_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_491406_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_492075_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_492152_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_493904_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_493918_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_493920_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_494000_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_494030_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_494170_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_494284_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_499522_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_503301_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_503593_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_503665_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_504513_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_507316_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_507513_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_50803_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_50804_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_510119_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_512208_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_513207_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_513240_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_5141_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_52393_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_54542_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_55185_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_56398_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_56399_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_56834_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_58444_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_58452_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_5861_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_60290_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_60294_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_60561_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_61147_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_6331_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_6399_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_64652_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_64657_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_65996_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_66666_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_67549_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_68080_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_6817_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_69250_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_70509_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_71759_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_71774_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_73487_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_73796_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_74728_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_75089_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_75391_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_77962_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_78386_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_82069_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_82070_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_83493_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_83494_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_83512_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_83602_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_84090_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_84528_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_87720_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_87721_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_89597_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_93891_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_94842_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_94844_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_96282_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_96298_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_96557_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_96886_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_97738_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_97739_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_9807_LIHC_TCGA-DD-A39Y-01.png | |
exon_skip_98550_LIHC_TCGA-DD-A39Y-01.png | |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| RXF393_KIDNEY | 7747071 | 7747145 | 7747089 | 7747089 | Missense_Mutation | C | G | p.L35V |
| TTC709_SOFT_TISSUE | 7749164 | 7749196 | 7749176 | 7749176 | Missense_Mutation | G | A | p.G58R |
| KYSE30_OESOPHAGUS | 7749164 | 7749196 | 7749177 | 7749177 | Missense_Mutation | G | A | p.G58E |
| HT115_LARGE_INTESTINE | 7750985 | 7751154 | 7751037 | 7751037 | Missense_Mutation | C | T | p.T82I |
| HS936T_SKIN | 7750985 | 7751154 | 7751043 | 7751043 | Missense_Mutation | G | T | p.R84L |
| HEC1_ENDOMETRIUM | 7750985 | 7751154 | 7751055 | 7751055 | Missense_Mutation | C | T | p.T88I |
| MONOMAC1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 7750985 | 7751154 | 7751088 | 7751088 | Missense_Mutation | C | T | p.P99L |
| MONOMAC6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 7750985 | 7751154 | 7751088 | 7751088 | Missense_Mutation | C | T | p.P99L |
| CAL851_BREAST | 7755144 | 7755248 | 7755221 | 7755221 | Missense_Mutation | C | A | p.A147E |
| KARPAS45_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 7762819 | 7762926 | 7762823 | 7762823 | Missense_Mutation | A | G | p.D212G |
| NCIH524_LUNG | 7762819 | 7762926 | 7762828 | 7762828 | Missense_Mutation | T | A | p.W214R |
| KYSE410_OESOPHAGUS | 7762819 | 7762926 | 7762874 | 7762874 | Missense_Mutation | C | G | p.T229R |
| COLO741_SKIN | 7762819 | 7762926 | 7762876 | 7762876 | Missense_Mutation | T | C | p.F230L |
| IGR1_SKIN | 7762819 | 7762926 | 7762900 | 7762900 | Missense_Mutation | C | T | p.P238S |
| NCIH446_LUNG | 7763612 | 7763740 | 7763649 | 7763649 | Missense_Mutation | G | T | p.R259I |
| 451LU_SKIN | 7763612 | 7763740 | 7763649 | 7763649 | Missense_Mutation | G | A | p.R259K |
| MOLT3_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 7763612 | 7763740 | 7763664 | 7763664 | Missense_Mutation | G | T | p.C264F |
| MOLT16_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 7763612 | 7763740 | 7763667 | 7763667 | Missense_Mutation | G | A | p.R265Q |
| LS411N_LARGE_INTESTINE | 7763612 | 7763740 | 7763673 | 7763673 | Missense_Mutation | C | A | p.T267N |
| D425_CENTRAL_NERVOUS_SYSTEM | 7763612 | 7763740 | 7763676 | 7763676 | Missense_Mutation | C | T | p.A268V |
| D458_CENTRAL_NERVOUS_SYSTEM | 7763612 | 7763740 | 7763676 | 7763676 | Missense_Mutation | C | T | p.A268V |
| SNGM_ENDOMETRIUM | 7763612 | 7763740 | 7763676 | 7763676 | Missense_Mutation | C | T | p.A268V |
| NCIH1623_LUNG | 7763612 | 7763740 | 7763678 | 7763678 | Missense_Mutation | G | A | p.V269I |
| WM278_SKIN | 7763612 | 7763740 | 7763687 | 7763687 | Missense_Mutation | G | A | p.E272K |
| HEC6_ENDOMETRIUM | 7769666 | 7769791 | 7769749 | 7769749 | Missense_Mutation | G | A | p.V413I |
| MC116_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 7769666 | 7769791 | 7769749 | 7769749 | Missense_Mutation | G | A | p.V413I |
| DBTRG05MG_CENTRAL_NERVOUS_SYSTEM | 7773774 | 7773959 | 7773808 | 7773808 | Missense_Mutation | G | A | p.R499Q |
| VMRCLCD_LUNG | 7773774 | 7773959 | 7773849 | 7773849 | Missense_Mutation | G | A | p.V513I |
| WM793_SKIN | 7773774 | 7773959 | 7773927 | 7773927 | Missense_Mutation | G | A | p.D539N |
| SARC9371_BONE | 7776885 | 7777054 | 7776914 | 7776914 | Missense_Mutation | G | A | p.R606K |
| ECC10_STOMACH | 7776885 | 7777054 | 7776977 | 7776977 | Missense_Mutation | C | T | p.S627L |
| AMO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 7776885 | 7777054 | 7776996 | 7776996 | Missense_Mutation | G | C | p.E633D |
| HT115_LARGE_INTESTINE | 7780584 | 7780721 | 7780629 | 7780629 | Missense_Mutation | C | A | p.S668Y |
| MDAPCA2B_PROSTATE | 7780584 | 7780721 | 7780670 | 7780670 | Missense_Mutation | G | T | p.A682S |
| MZ7MEL_SKIN | 7786045 | 7786243 | 7786059 | 7786059 | Missense_Mutation | G | A | p.G742S |
| OVCAR4_OVARY | 7786045 | 7786243 | 7786148 | 7786148 | Missense_Mutation | A | G | p.I771M |
| KMH2_THYROID | 7786045 | 7786243 | 7786163 | 7786163 | Missense_Mutation | C | G | p.S776R |
| HGC27_STOMACH | 7786045 | 7786243 | 7786173 | 7786173 | Missense_Mutation | A | C | p.I780L |
| EWS834_BONE | 7786045 | 7786243 | 7786188 | 7786188 | Missense_Mutation | G | A | p.G785S |
| L1236_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 7755144 | 7755248 | 7755196 | 7755196 | Nonsense_Mutation | C | T | p.R139* |
| NB7_AUTONOMIC_GANGLIA | 7762819 | 7762926 | 7762837 | 7762837 | Nonsense_Mutation | G | T | p.E217* |
| NCIH23_LUNG | 7780584 | 7780721 | 7780682 | 7780682 | Nonsense_Mutation | C | T | p.Q686* |
| 2313287_STOMACH | 7749164 | 7749196 | 7749196 | 7749196 | Splice_Site | G | A | p.M64I |
| NCIH2170_LUNG | 7763612 | 7763740 | 7763613 | 7763613 | Splice_Site | C | A | p.A247E |
| SNU81_LARGE_INTESTINE | 7773774 | 7773959 | 7773958 | 7773958 | Splice_Site | C | T | p.S549L |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for ITIH2 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for ITIH2 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for ITIH2 |
Top |
RelatedDrugs for ITIH2 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
| P19823 | DB01593 | Zinc | Inter-alpha-trypsin inhibitor heavy chain H2 | small molecule | approved|investigational | |
| P19823 | DB14487 | Zinc acetate | Inter-alpha-trypsin inhibitor heavy chain H2 | small molecule | approved|investigational | |
| P19823 | DB14533 | Zinc chloride | Inter-alpha-trypsin inhibitor heavy chain H2 | small molecule | approved|investigational |
Top |
RelatedDiseases for ITIH2 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|