|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for IL1RAP |
 Gene summary |
| Gene information | Gene symbol | IL1RAP | Gene ID | 3556 |
| Gene name | interleukin 1 receptor accessory protein | |
| Synonyms | C3orf13|IL-1RAcP|IL1R3 | |
| Cytomap | 3q28 | |
| Type of gene | protein-coding | |
| Description | interleukin-1 receptor accessory proteinIL-1 receptor accessory proteinIL-1R3interleukin-1 receptor 3interleukin-1 receptor accessory protein beta | |
| Modification date | 20180527 | |
| UniProtAcc | Q9NPH3 | |
| Context | PubMed: IL1RAP [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for IL1RAP from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for IL1RAP |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for IL1RAP |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_380551 | 3 | 190231907:190232008:190268130:190268294:190273918:190274005 | 190268130:190268294 | ENSG00000196083.5 | ENST00000439062.1 |
| exon_skip_380554 | 3 | 190231907:190232008:190273918:190274005:190282077:190282142 | 190273918:190274005 | ENSG00000196083.5 | ENST00000422485.1,ENST00000461629.1,ENST00000447382.1,ENST00000413869.1,ENST00000317757.3 |
| exon_skip_380556 | 3 | 190231907:190232008:190282077:190282142:190321916:190322191 | 190282077:190282142 | ENSG00000196083.5 | ENST00000342550.2,ENST00000443369.2,ENST00000422940.1 |
| exon_skip_380560 | 3 | 190268130:190268294:190273918:190274005:190282077:190282142 | 190273918:190274005 | ENSG00000196083.5 | ENST00000439062.1 |
| exon_skip_380561 | 3 | 190273918:190274005:190282077:190282142:190321916:190322191 | 190282077:190282142 | ENSG00000196083.5 | ENST00000422485.1,ENST00000439062.1,ENST00000447382.1,ENST00000413869.1,ENST00000317757.3 |
| exon_skip_380562 | 3 | 190321916:190322202:190326783:190326970:190338063:190338229 | 190326783:190326970 | ENSG00000196083.5 | ENST00000342550.2,ENST00000422485.1,ENST00000443369.2,ENST00000439062.1,ENST00000422940.1,ENST00000072516.3,ENST00000447382.1,ENST00000413869.1,ENST00000317757.3,ENST00000412504.2 |
| exon_skip_380563 | 3 | 190345111:190345238:190347138:190347287:190362036:190362186 | 190347138:190347287 | ENSG00000196083.5 | ENST00000443369.2,ENST00000439062.1,ENST00000072516.3,ENST00000447382.1,ENST00000317757.3,ENST00000412504.2 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for IL1RAP |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_380551 | 3 | 190231907:190232008:190268130:190268294:190273918:190274005 | 190268130:190268294 | ENSG00000196083.5 | ENST00000439062.1 |
| exon_skip_380554 | 3 | 190231907:190232008:190273918:190274005:190282077:190282142 | 190273918:190274005 | ENSG00000196083.5 | ENST00000447382.1,ENST00000422485.1,ENST00000413869.1,ENST00000317757.3,ENST00000461629.1 |
| exon_skip_380556 | 3 | 190231907:190232008:190282077:190282142:190321916:190322191 | 190282077:190282142 | ENSG00000196083.5 | ENST00000443369.2,ENST00000422940.1,ENST00000342550.2 |
| exon_skip_380560 | 3 | 190268130:190268294:190273918:190274005:190282077:190282142 | 190273918:190274005 | ENSG00000196083.5 | ENST00000439062.1 |
| exon_skip_380561 | 3 | 190273918:190274005:190282077:190282142:190321916:190322191 | 190282077:190282142 | ENSG00000196083.5 | ENST00000439062.1,ENST00000447382.1,ENST00000422485.1,ENST00000413869.1,ENST00000317757.3 |
| exon_skip_380562 | 3 | 190321916:190322202:190326783:190326970:190338063:190338229 | 190326783:190326970 | ENSG00000196083.5 | ENST00000072516.3,ENST00000443369.2,ENST00000412504.2,ENST00000439062.1,ENST00000447382.1,ENST00000422485.1,ENST00000422940.1,ENST00000413869.1,ENST00000342550.2,ENST00000317757.3 |
| exon_skip_380563 | 3 | 190345111:190345238:190347138:190347287:190362036:190362186 | 190347138:190347287 | ENSG00000196083.5 | ENST00000072516.3,ENST00000443369.2,ENST00000412504.2,ENST00000439062.1,ENST00000447382.1,ENST00000317757.3 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for IL1RAP |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000439062 | 190282077 | 190282142 | 5CDS-5UTR |
| ENST00000447382 | 190282077 | 190282142 | 5CDS-5UTR |
| ENST00000439062 | 190268130 | 190268294 | 5UTR-5UTR |
| ENST00000439062 | 190273918 | 190274005 | 5UTR-5UTR |
| ENST00000447382 | 190273918 | 190274005 | 5UTR-5UTR |
| ENST00000072516 | 190326783 | 190326970 | Frame-shift |
| ENST00000412504 | 190326783 | 190326970 | Frame-shift |
| ENST00000439062 | 190326783 | 190326970 | Frame-shift |
| ENST00000447382 | 190326783 | 190326970 | Frame-shift |
| ENST00000072516 | 190347138 | 190347287 | Frame-shift |
| ENST00000412504 | 190347138 | 190347287 | Frame-shift |
| ENST00000439062 | 190347138 | 190347287 | Frame-shift |
| ENST00000447382 | 190347138 | 190347287 | Frame-shift |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000439062 | 190282077 | 190282142 | 5CDS-5UTR |
| ENST00000447382 | 190282077 | 190282142 | 5CDS-5UTR |
| ENST00000439062 | 190268130 | 190268294 | 5UTR-5UTR |
| ENST00000439062 | 190273918 | 190274005 | 5UTR-5UTR |
| ENST00000447382 | 190273918 | 190274005 | 5UTR-5UTR |
| ENST00000072516 | 190326783 | 190326970 | Frame-shift |
| ENST00000412504 | 190326783 | 190326970 | Frame-shift |
| ENST00000439062 | 190326783 | 190326970 | Frame-shift |
| ENST00000447382 | 190326783 | 190326970 | Frame-shift |
| ENST00000072516 | 190347138 | 190347287 | Frame-shift |
| ENST00000412504 | 190347138 | 190347287 | Frame-shift |
| ENST00000439062 | 190347138 | 190347287 | Frame-shift |
| ENST00000447382 | 190347138 | 190347287 | Frame-shift |
Top |
Infer the effects of exon skipping event on protein functional features for IL1RAP |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
Top |
SNVs in the skipped exons for IL1RAP |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| UCEC | TCGA-B5-A11Y-01 | exon_skip_380562 | 190326784 | 190326970 | 190326882 | 190326904 | Frame_Shift_Del | ATATAGAATATGGCATTCAGAGG | - | p.I151fs |
| UCEC | TCGA-A5-A0R8-01 | exon_skip_380562 | 190326784 | 190326970 | 190326902 | 190326976 | Frame_Shift_Del | AGGATCACTTGTCCAAATGTAGATGGATATTTTCCTTCCAGTGTCAAACCGACTATCACTTGGTATATGGTAAGG | - | p.R157fs |
| BLCA | TCGA-K4-A4AC-01 | exon_skip_380562 | 190326784 | 190326970 | 190326899 | 190326899 | Nonsense_Mutation | C | T | p.Q156* |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 190282078 | 190282142 | 190282136 | 190282136 | Missense_Mutation | G | T | p.A20S |
| KCL22_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 190326784 | 190326970 | 190326798 | 190326798 | Missense_Mutation | G | A | p.C122Y |
| SNGM_ENDOMETRIUM | 190326784 | 190326970 | 190326801 | 190326801 | Missense_Mutation | G | A | p.S123N |
| UMUC3_URINARY_TRACT | 190326784 | 190326970 | 190326815 | 190326815 | Missense_Mutation | C | A | p.P128T |
| MCC13_SKIN | 190326784 | 190326970 | 190326816 | 190326816 | Missense_Mutation | C | T | p.P128L |
| FU97_STOMACH | 190326784 | 190326970 | 190326942 | 190326942 | Missense_Mutation | G | A | p.S170N |
| HEC1B_ENDOMETRIUM | 190326784 | 190326970 | 190326951 | 190326951 | Missense_Mutation | C | T | p.P173L |
| HEC251_ENDOMETRIUM | 190347139 | 190347287 | 190347254 | 190347254 | Missense_Mutation | G | A | p.E340K |
| L540_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 190347139 | 190347287 | 190347263 | 190347263 | Missense_Mutation | A | G | p.K343E |
| KP3_PANCREAS | 190347139 | 190347287 | 190347140 | 190347140 | Splice_Site | A | G | p.I302V |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for IL1RAP |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for IL1RAP |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for IL1RAP |
Top |
RelatedDrugs for IL1RAP |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for IL1RAP |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| IL1RAP | C0023895 | Liver diseases | 1 | CTD_human |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|