|
||||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | Open reading frame (ORF) annotation in the exon skipping event |
![]() | |
![]() | |
![]() | Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
![]() | Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
![]() | |
![]() |
Gene summary for IFRD1 |
Gene summary |
| Gene information | Gene symbol | IFRD1 | Gene ID | 3475 |
| Gene name | interferon related developmental regulator 1 | |
| Synonyms | PC4|TIS7 | |
| Cytomap | 7q31.1 | |
| Type of gene | protein-coding | |
| Description | interferon-related developmental regulator 112-O-tetradecanoylphorbol-13-acetate-induced sequence 7TPA induced sequence 7nerve growth factor-inducible protein PC4pheochromocytoma cell-4 | |
| Modification date | 20180523 | |
| UniProtAcc | O00458 | |
| Context | PubMed: IFRD1 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for IFRD1 from UCSC genome browser |
Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Gene isoform structures and expression levels for IFRD1 |
Expression levels of gene isoforms across TCGA. |
Expression levels of gene isoforms across GTEx. |
Top |
Exon skipping events with PSIs in TCGA for IFRD1 |
Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_470574 | 7 | 112063422:112063487:112090562:112090837:112095817:112095910 | 112090562:112090837 | ENSG00000006652.9 | ENST00000005558.4 |
| exon_skip_470576 | 7 | 112097050:112097093:112098915:112099073:112101920:112101971 | 112098915:112099073 | ENSG00000006652.9 | ENST00000403825.3,ENST00000005558.4,ENST00000535603.1,ENST00000466459.1 |
| exon_skip_470579 | 7 | 112098915:112099073:112101920:112101971:112102055:112102177 | 112101920:112101971 | ENSG00000006652.9 | ENST00000403825.3,ENST00000005558.4,ENST00000535603.1,ENST00000466459.1,ENST00000486688.1 |
| exon_skip_470580 | 7 | 112101920:112101971:112102055:112102234:112108035:112108159 | 112102055:112102234 | ENSG00000006652.9 | ENST00000466459.1 |
| exon_skip_470581 | 7 | 112102055:112102234:112102324:112102433:112108035:112108159 | 112102324:112102433 | ENSG00000006652.9 | ENST00000421296.1,ENST00000403825.3,ENST00000005558.4,ENST00000535603.1 |
PSI values of skipped exons in TCGA. |
Top |
Exon skipping events with PSIs in GTEx for IFRD1 |
Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_470574 | 7 | 112063422:112063487:112090562:112090837:112095817:112095910 | 112090562:112090837 | ENSG00000006652.9 | ENST00000005558.4 |
| exon_skip_470576 | 7 | 112097050:112097093:112098915:112099073:112101920:112101971 | 112098915:112099073 | ENSG00000006652.9 | ENST00000005558.4,ENST00000403825.3,ENST00000535603.1,ENST00000466459.1 |
| exon_skip_470579 | 7 | 112098915:112099073:112101920:112101971:112102055:112102177 | 112101920:112101971 | ENSG00000006652.9 | ENST00000005558.4,ENST00000403825.3,ENST00000535603.1,ENST00000466459.1,ENST00000486688.1 |
| exon_skip_470580 | 7 | 112101920:112101971:112102055:112102234:112108035:112108159 | 112102055:112102234 | ENSG00000006652.9 | ENST00000466459.1 |
| exon_skip_470581 | 7 | 112102055:112102234:112102324:112102433:112108035:112108159 | 112102324:112102433 | ENSG00000006652.9 | ENST00000005558.4,ENST00000403825.3,ENST00000535603.1,ENST00000421296.1 |
PSI values of skipped exons in GTEx. |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for IFRD1 |
Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000005558 | 112090562 | 112090837 | 5CDS-5UTR |
| ENST00000005558 | 112098915 | 112099073 | Frame-shift |
| ENST00000403825 | 112098915 | 112099073 | Frame-shift |
| ENST00000005558 | 112102324 | 112102433 | Frame-shift |
| ENST00000403825 | 112102324 | 112102433 | Frame-shift |
| ENST00000005558 | 112101920 | 112101971 | In-frame |
| ENST00000403825 | 112101920 | 112101971 | In-frame |
Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000005558 | 112090562 | 112090837 | 5CDS-5UTR |
| ENST00000005558 | 112098915 | 112099073 | Frame-shift |
| ENST00000403825 | 112098915 | 112099073 | Frame-shift |
| ENST00000005558 | 112102324 | 112102433 | Frame-shift |
| ENST00000403825 | 112102324 | 112102433 | Frame-shift |
| ENST00000005558 | 112101920 | 112101971 | In-frame |
| ENST00000403825 | 112101920 | 112101971 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for IFRD1 |
Exon skipping at the protein sequence level and followed lost functional features.* Click on the image to enlarge it in a new window. |
![]() |
Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000005558 | 1851 | 451 | 112101920 | 112101971 | 1038 | 1088 | 189 | 206 |
| ENST00000403825 | 2307 | 451 | 112101920 | 112101971 | 829 | 879 | 189 | 206 |
Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000005558 | 1851 | 451 | 112101920 | 112101971 | 1038 | 1088 | 189 | 206 |
| ENST00000403825 | 2307 | 451 | 112101920 | 112101971 | 829 | 879 | 189 | 206 |
Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| O00458 | 189 | 206 | 1 | 451 | Chain | ID=PRO_0000153285;Note=Interferon-related developmental regulator 1 |
| O00458 | 189 | 206 | 1 | 451 | Chain | ID=PRO_0000153285;Note=Interferon-related developmental regulator 1 |
Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| O00458 | 189 | 206 | 1 | 451 | Chain | ID=PRO_0000153285;Note=Interferon-related developmental regulator 1 |
| O00458 | 189 | 206 | 1 | 451 | Chain | ID=PRO_0000153285;Note=Interferon-related developmental regulator 1 |
Top |
SNVs in the skipped exons for IFRD1 |
- Lollipop plot for presenting exon skipping associated SNVs.* Click on the image to enlarge it in a new window. |
- Differential PSIs between mutated versus non-mutated samples. |
- Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_470576 | 112098916 | 112099073 | 112099000 | 112099000 | Frame_Shift_Del | T | - | p.I165fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_470576 | 112098916 | 112099073 | 112099005 | 112099005 | Frame_Shift_Del | A | - | p.K167fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_470576 | 112098916 | 112099073 | 112099029 | 112099029 | Frame_Shift_Del | A | - | p.K175fs |
| UCEC | TCGA-A5-A0R8-01 | exon_skip_470580 | 112102056 | 112102234 | 112102120 | 112102148 | Frame_Shift_Del | ACACTACTGTTATTTGCAGCACTCCTAAT | - | p.D228fs |
| CHOL | TCGA-3X-AAVE-01 | exon_skip_470580 | 112102056 | 112102234 | 112102177 | 112102178 | Frame_Shift_Ins | - | A | p.A247fs |
| CHOL | TCGA-3X-AAVE-01 | exon_skip_470580 | 112102056 | 112102234 | 112102177 | 112102178 | Frame_Shift_Ins | - | A | p.V247fs |
| LIHC | TCGA-DD-A3A9-01 | exon_skip_470580 | 112102056 | 112102234 | 112102235 | 112102235 | Splice_Site | G | A | . |
- Depth of coverage in the three exons composing exon skipping event |
- Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 112098916 | 112099073 | 112098919 | 112098919 | Missense_Mutation | A | G | p.K138R |
| NALM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 112098916 | 112099073 | 112098934 | 112098934 | Missense_Mutation | G | A | p.R143H |
| NCIH1563_LUNG | 112098916 | 112099073 | 112099011 | 112099011 | Missense_Mutation | C | T | p.L169F |
| BICR18_UPPER_AERODIGESTIVE_TRACT | 112101921 | 112101971 | 112101945 | 112101945 | Missense_Mutation | T | A | p.C198S |
| MFE319_ENDOMETRIUM | 112102056 | 112102234 | 112102083 | 112102083 | Missense_Mutation | G | A | p.E216K |
| ISHIKAWAHERAKLIO02ER_ENDOMETRIUM | 112102056 | 112102234 | 112102101 | 112102101 | Missense_Mutation | T | C | p.S222P |
| KPMRTRY_SOFT_TISSUE | 112102056 | 112102234 | 112102105 | 112102105 | Missense_Mutation | A | T | p.Y223F |
| HCC2998_LARGE_INTESTINE | 112102056 | 112102234 | 112102111 | 112102111 | Missense_Mutation | A | C | p.K225T |
| COLO680N_OESOPHAGUS | 112102056 | 112102234 | 112102173 | 112102173 | Missense_Mutation | C | T | p.L246F |
| PEDS015T_SOFT_TISSUE | 112102056 | 112102234 | 112102222 | 112102222 | Missense_Mutation | A | G | p.K262R |
| PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 112102325 | 112102433 | 112102348 | 112102348 | Missense_Mutation | T | C | p.L274P |
| GCIY_STOMACH | 112102325 | 112102433 | 112102373 | 112102373 | Missense_Mutation | G | A | p.M282I |
| KOSC2_UPPER_AERODIGESTIVE_TRACT | 112102325 | 112102433 | 112102427 | 112102427 | Missense_Mutation | A | G | p.I300M |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for IFRD1 |
sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
| exon_skip_470581 | 7 | 112102055:112102234:112102324:112102433:112108035:112108159 | 112102324:112102433 | ENST00000421296.1,ENST00000403825.3,ENST00000005558.4,ENST00000535603.1 | LUAD | rs2253962 | chr7:112102355 | T/G | 4.81e-04 |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for IFRD1 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for IFRD1 |
Top |
RelatedDrugs for IFRD1 |
Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for IFRD1 |
Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| IFRD1 | C0023893 | Liver Cirrhosis, Experimental | 1 | CTD_human |
| IFRD1 | C0035222 | Respiratory Distress Syndrome, Adult | 1 | CTD_human |