|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for SEC61A1 |
 Gene summary |
| Gene information | Gene symbol | SEC61A1 | Gene ID | 29927 |
| Gene name | Sec61 translocon alpha 1 subunit | |
| Synonyms | HNFJ4|HSEC61|SEC61|SEC61A | |
| Cytomap | 3q21.3 | |
| Type of gene | protein-coding | |
| Description | protein transport protein Sec61 subunit alpha isoform 1Sec61 alpha 1 subunitSec61 alpha-1protein transport protein SEC61 alpha subunitprotein transport protein Sec61 subunit alphasec61 homolog | |
| Modification date | 20180527 | |
| UniProtAcc | P61619 | |
| Context | PubMed: SEC61A1 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for SEC61A1 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for SEC61A1 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for SEC61A1 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_377359 | 3 | 127771268:127771402:127771677:127771745:127774358:127774424 | 127771677:127771745 | ENSG00000058262.5 | ENST00000243253.3 |
| exon_skip_377362 | 3 | 127774358:127774424:127774515:127774594:127775551:127775683 | 127774515:127774594 | ENSG00000058262.5 | ENST00000243253.3,ENST00000464451.1,ENST00000481210.1 |
| exon_skip_377363 | 3 | 127774515:127774594:127775551:127775683:127778944:127779054 | 127775551:127775683 | ENSG00000058262.5 | ENST00000243253.3,ENST00000464451.1,ENST00000481210.1 |
| exon_skip_377365 | 3 | 127783719:127783880:127785796:127785994:127786263:127786455 | 127785796:127785994 | ENSG00000058262.5 | ENST00000243253.3,ENST00000424880.2,ENST00000464451.1 |
| exon_skip_377369 | 3 | 127783863:127784099:127785451:127785546:127785796:127785994 | 127785451:127785546 | ENSG00000058262.5 | ENST00000483956.1 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for SEC61A1 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_377359 | 3 | 127771268:127771402:127771677:127771745:127774358:127774424 | 127771677:127771745 | ENSG00000058262.5 | ENST00000243253.3 |
| exon_skip_377362 | 3 | 127774358:127774424:127774515:127774594:127775551:127775683 | 127774515:127774594 | ENSG00000058262.5 | ENST00000464451.1,ENST00000243253.3,ENST00000481210.1 |
| exon_skip_377363 | 3 | 127774515:127774594:127775551:127775683:127778944:127779054 | 127775551:127775683 | ENSG00000058262.5 | ENST00000464451.1,ENST00000243253.3,ENST00000481210.1 |
| exon_skip_377365 | 3 | 127783719:127783880:127785796:127785994:127786263:127786455 | 127785796:127785994 | ENSG00000058262.5 | ENST00000464451.1,ENST00000243253.3,ENST00000424880.2 |
| exon_skip_377369 | 3 | 127783863:127784099:127785451:127785546:127785796:127785994 | 127785451:127785546 | ENSG00000058262.5 | ENST00000483956.1 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for SEC61A1 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000243253 | 127771677 | 127771745 | Frame-shift |
| ENST00000243253 | 127774515 | 127774594 | Frame-shift |
| ENST00000243253 | 127775551 | 127775683 | In-frame |
| ENST00000243253 | 127785796 | 127785994 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000243253 | 127771677 | 127771745 | Frame-shift |
| ENST00000243253 | 127774515 | 127774594 | Frame-shift |
| ENST00000243253 | 127775551 | 127775683 | In-frame |
| ENST00000243253 | 127785796 | 127785994 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for SEC61A1 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000243253 | 3652 | 476 | 127775551 | 127775683 | 405 | 536 | 73 | 117 |
| ENST00000243253 | 3652 | 476 | 127785796 | 127785994 | 962 | 1159 | 259 | 325 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000243253 | 3652 | 476 | 127775551 | 127775683 | 405 | 536 | 73 | 117 |
| ENST00000243253 | 3652 | 476 | 127785796 | 127785994 | 962 | 1159 | 259 | 325 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
Top |
SNVs in the skipped exons for SEC61A1 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_377359 | 127771678 | 127771745 | 127771731 | 127771731 | Frame_Shift_Del | A | - | p.K21fs |
| BLCA | TCGA-XF-AAMX-01 | exon_skip_377363 | 127775552 | 127775683 | 127775579 | 127775580 | Frame_Shift_Ins | - | TA | p.PI83fs |
| UCS | TCGA-ND-A4WC-01 | exon_skip_377365 | 127785797 | 127785994 | 127785899 | 127785899 | Nonsense_Mutation | C | T | p.Q294* |
| UCS | TCGA-ND-A4WC-01 | exon_skip_377365 | 127785797 | 127785994 | 127785899 | 127785899 | Nonsense_Mutation | C | T | p.Q294X |
| LUAD | TCGA-64-1680-01 | exon_skip_377365 | 127785797 | 127785994 | 127785935 | 127785935 | Nonsense_Mutation | C | T | p.Q306* |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| HCC2450_LUNG | 127771678 | 127771745 | 127771737 | 127771737 | Missense_Mutation | G | C | p.E23Q |
| KYSE510_OESOPHAGUS | 127775552 | 127775683 | 127775576 | 127775576 | Missense_Mutation | C | T | p.S82F |
| NCIH2291_LUNG | 127775552 | 127775683 | 127775666 | 127775666 | Missense_Mutation | T | G | p.F112C |
| SNUC5_LARGE_INTESTINE | 127785797 | 127785994 | 127785812 | 127785812 | Missense_Mutation | C | A | p.L265M |
| CW2_LARGE_INTESTINE | 127785797 | 127785994 | 127785896 | 127785896 | Missense_Mutation | C | A | p.L293M |
| HEC59_ENDOMETRIUM | 127775552 | 127775683 | 127775656 | 127775656 | Nonsense_Mutation | C | T | p.R109* |
| SNUC4_LARGE_INTESTINE | 127774516 | 127774594 | 127774421 | 127774511 | Splice_Site | CCAGGTAAGCTCAGGCTTGTATTTCGTATTGGGGAGGGGGATAAGAGTGGCTGGAAACAGGAGTGCTGACTGTTTTGCTCTTTGCCTGTTC | - | p.CQ46fs |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for SEC61A1 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for SEC61A1 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for SEC61A1 |
Top |
RelatedDrugs for SEC61A1 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for SEC61A1 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| SEC61A1 | C0376634 | Craniofacial Abnormalities | 1 | CTD_human |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|