|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for EEF2K |
 Gene summary |
| Gene information | Gene symbol | EEF2K | Gene ID | 29904 |
| Gene name | eukaryotic elongation factor 2 kinase | |
| Synonyms | HSU93850|eEF-2K | |
| Cytomap | 16p12.2 | |
| Type of gene | protein-coding | |
| Description | eukaryotic elongation factor 2 kinasealternative protein EEF2Kcalcium/calmodulin-dependent eukaryotic elongation factor-2 kinasecalmodulin-dependent protein kinase IIIeEF-2 kinaseelongation factor-2 kinaseeukaroytic elongation factor 2 kinase | |
| Modification date | 20180519 | |
| UniProtAcc | O00418 | |
| Context | PubMed: EEF2K [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| EEF2K | GO:0046777 | protein autophosphorylation | 9144159|23184662 |
Top |
Exon skipping events across known transcript of Ensembl for EEF2K from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for EEF2K |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for EEF2K |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_134559 | 16 | 22217646:22218000:22236974:22237296:22255950:22256051 | 22236974:22237296 | ENSG00000103319.7 | ENST00000568269.1 |
| exon_skip_134560 | 16 | 22255950:22256051:22260075:22260136:22261974:22262012 | 22260075:22260136 | ENSG00000103319.7 | ENST00000568269.1,ENST00000263026.5 |
| exon_skip_134563 | 16 | 22260075:22260136:22261974:22262012:22262471:22262643 | 22261974:22262012 | ENSG00000103319.7 | ENST00000568269.1,ENST00000263026.5 |
| exon_skip_134565 | 16 | 22268573:22268706:22268963:22269091:22269814:22270016 | 22268963:22269091 | ENSG00000103319.7 | ENST00000568269.1,ENST00000263026.5 |
| exon_skip_134567 | 16 | 22269814:22270016:22271782:22271850:22274430:22274508 | 22271782:22271850 | ENSG00000103319.7 | ENST00000563555.1,ENST00000263026.5 |
| exon_skip_134569 | 16 | 22271782:22271850:22274430:22274508:22276138:22276201 | 22274430:22274508 | ENSG00000103319.7 | ENST00000568269.1,ENST00000263026.5 |
| exon_skip_134570 | 16 | 22274430:22274508:22276138:22276201:22277710:22277845 | 22276138:22276201 | ENSG00000103319.7 | ENST00000263026.5 |
| exon_skip_134571 | 16 | 22276138:22276201:22277710:22277845:22278008:22278197 | 22277710:22277845 | ENSG00000103319.7 | ENST00000263026.5 |
| exon_skip_134572 | 16 | 22278008:22278197:22284946:22285071:22291518:22291697 | 22284946:22285071 | ENSG00000103319.7 | ENST00000263026.5 |
| exon_skip_134576 | 16 | 22284946:22285071:22291518:22291697:22295207:22297954 | 22291518:22291697 | ENSG00000103319.7 | ENST00000263026.5 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for EEF2K |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_134559 | 16 | 22217646:22218000:22236974:22237296:22255950:22256051 | 22236974:22237296 | ENSG00000103319.7 | ENST00000568269.1 |
| exon_skip_134560 | 16 | 22255950:22256051:22260075:22260136:22261974:22262012 | 22260075:22260136 | ENSG00000103319.7 | ENST00000263026.5,ENST00000568269.1 |
| exon_skip_134563 | 16 | 22260075:22260136:22261974:22262012:22262471:22262643 | 22261974:22262012 | ENSG00000103319.7 | ENST00000263026.5,ENST00000568269.1 |
| exon_skip_134565 | 16 | 22268573:22268706:22268963:22269091:22269814:22270016 | 22268963:22269091 | ENSG00000103319.7 | ENST00000263026.5,ENST00000568269.1 |
| exon_skip_134567 | 16 | 22269814:22270016:22271782:22271850:22274430:22274508 | 22271782:22271850 | ENSG00000103319.7 | ENST00000263026.5,ENST00000563555.1 |
| exon_skip_134569 | 16 | 22271782:22271850:22274430:22274508:22276138:22276201 | 22274430:22274508 | ENSG00000103319.7 | ENST00000263026.5,ENST00000568269.1 |
| exon_skip_134570 | 16 | 22274430:22274508:22276138:22276201:22277710:22277845 | 22276138:22276201 | ENSG00000103319.7 | ENST00000263026.5 |
| exon_skip_134571 | 16 | 22276138:22276201:22277710:22277845:22278008:22278197 | 22277710:22277845 | ENSG00000103319.7 | ENST00000263026.5 |
| exon_skip_134572 | 16 | 22278008:22278197:22284946:22285071:22291518:22291697 | 22284946:22285071 | ENSG00000103319.7 | ENST00000263026.5 |
| exon_skip_134576 | 16 | 22284946:22285071:22291518:22291697:22295207:22297954 | 22291518:22291697 | ENSG00000103319.7 | ENST00000263026.5 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for EEF2K |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
Top |
Infer the effects of exon skipping event on protein functional features for EEF2K |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
Top |
SNVs in the skipped exons for EEF2K |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_134559 | 22236975 | 22237296 | 22237278 | 22237278 | Frame_Shift_Del | A | - | p.A76fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_134576 | 22291519 | 22291697 | 22291616 | 22291616 | Frame_Shift_Del | C | - | p.P663fs |
| LUSC | TCGA-39-5019-01 | exon_skip_134563 | 22261975 | 22262012 | 22261999 | 22261999 | Nonsense_Mutation | G | T | p.E145* |
| BRCA | TCGA-BH-A0AY-01 | exon_skip_134576 | 22291519 | 22291697 | 22291592 | 22291592 | Nonsense_Mutation | G | T | p.E655* |
| LUSC | TCGA-60-2721-01 | exon_skip_134576 | 22291519 | 22291697 | 22291592 | 22291592 | Nonsense_Mutation | G | T | p.E655* |
| COAD | TCGA-G4-6302-01 | exon_skip_134576 | 22291519 | 22291697 | 22291688 | 22291688 | Nonsense_Mutation | C | T | p.Q687X |
| HNSC | TCGA-CV-7101-01 | exon_skip_134567 | 22271783 | 22271850 | 22271782 | 22271782 | Splice_Site | G | C | p.H411_splice |
| LUAD | TCGA-95-7567-01 | exon_skip_134571 | 22277711 | 22277845 | 22277709 | 22277709 | Splice_Site | A | C | p.V481_splice |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| KMRC20_KIDNEY | 22284947 | 22285071 | 22284966 | 22284966 | Frame_Shift_Del | C | - | p.T595fs |
| KMM1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 22236975 | 22237296 | 22237169 | 22237189 | In_Frame_Del | GCCCCATCACGGATGACCCAA | - | p.PITDDPS41del |
| SNU1040_LARGE_INTESTINE | 22236975 | 22237296 | 22237205 | 22237205 | Missense_Mutation | T | C | p.V52A |
| KARPAS45_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 22236975 | 22237296 | 22237255 | 22237255 | Missense_Mutation | T | C | p.Y69H |
| U266B1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 22236975 | 22237296 | 22237255 | 22237255 | Missense_Mutation | T | C | p.Y69H |
| NCIH510_LUNG | 22260076 | 22260136 | 22260086 | 22260086 | Missense_Mutation | G | A | p.V120I |
| L428_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 22268964 | 22269091 | 22268970 | 22268970 | Missense_Mutation | G | A | p.R303H |
| CROAP2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 22268964 | 22269091 | 22269053 | 22269053 | Missense_Mutation | C | T | p.R331W |
| SNUC4_LARGE_INTESTINE | 22271783 | 22271850 | 22271797 | 22271797 | Missense_Mutation | A | G | p.S416G |
| DND41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 22274431 | 22274508 | 22274444 | 22274444 | Missense_Mutation | G | A | p.S438N |
| CME1_SOFT_TISSUE | 22274431 | 22274508 | 22274504 | 22274504 | Missense_Mutation | A | G | p.E458G |
| PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 22277711 | 22277845 | 22277716 | 22277716 | Missense_Mutation | T | G | p.C482W |
| FTC133_THYROID | 22284947 | 22285071 | 22284991 | 22284991 | Missense_Mutation | G | T | p.K603N |
| SNU324_PANCREAS | 22284947 | 22285071 | 22285032 | 22285032 | Missense_Mutation | C | T | p.A617V |
| HCC1569_BREAST | 22291519 | 22291697 | 22291550 | 22291550 | Missense_Mutation | T | C | p.Y641H |
| SLR26_KIDNEY | 22291519 | 22291697 | 22291574 | 22291574 | Missense_Mutation | G | A | p.D649N |
| HEC151_ENDOMETRIUM | 22291519 | 22291697 | 22291626 | 22291626 | Missense_Mutation | T | C | p.M666T |
| HEC151_ENDOMETRIUM | 22291519 | 22291697 | 22291646 | 22291646 | Missense_Mutation | G | A | p.E673K |
| BC3_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 22291519 | 22291697 | 22291648 | 22291648 | Missense_Mutation | G | C | p.E673D |
| KIJK_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 22236975 | 22237296 | 22237296 | 22237296 | Splice_Site | G | A | p.K82K |
| MFE319_ENDOMETRIUM | 22277711 | 22277845 | 22277711 | 22277711 | Splice_Site | G | A | p.V481I |
| SUM149PT_BREAST | 22277711 | 22277845 | 22277845 | 22277845 | Splice_Site | G | C | p.K525N |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for EEF2K |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for EEF2K |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for EEF2K |
Top |
RelatedDrugs for EEF2K |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for EEF2K |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|