|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for BRD7 |
 Gene summary |
| Gene information | Gene symbol | BRD7 | Gene ID | 29117 |
| Gene name | bromodomain containing 7 | |
| Synonyms | BP75|CELTIX1|NAG4 | |
| Cytomap | 16q12.1 | |
| Type of gene | protein-coding | |
| Description | bromodomain-containing protein 775 kDa bromodomain proteinprotein CELTIX-1 | |
| Modification date | 20180519 | |
| UniProtAcc | Q9NPI1 | |
| Context | PubMed: BRD7 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| BRD7 | GO:0006357 | regulation of transcription by RNA polymerase II | 12489984 |
| BRD7 | GO:0008285 | negative regulation of cell proliferation | 20228809 |
| BRD7 | GO:0035066 | positive regulation of histone acetylation | 20228809 |
| BRD7 | GO:0045892 | negative regulation of transcription, DNA-templated | 16265664 |
| BRD7 | GO:0045893 | positive regulation of transcription, DNA-templated | 20228809 |
| BRD7 | GO:2000134 | negative regulation of G1/S transition of mitotic cell cycle | 16265664 |
Top |
Exon skipping events across known transcript of Ensembl for BRD7 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for BRD7 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for BRD7 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_144284 | 16 | 50354573:50354685:50355892:50355949:50357497:50357609 | 50355892:50355949 | ENSG00000166164.11 | ENST00000394688.3 |
| exon_skip_144286 | 16 | 50354573:50354688:50355892:50355949:50357497:50357609 | 50355892:50355949 | ENSG00000166164.11 | ENST00000394689.2 |
| exon_skip_144287 | 16 | 50355892:50355949:50357497:50357609:50359658:50359766 | 50357497:50357609 | ENSG00000166164.11 | ENST00000394689.2,ENST00000394688.3 |
| exon_skip_144289 | 16 | 50359658:50359794:50360194:50360302:50362579:50362655 | 50360194:50360302 | ENSG00000166164.11 | ENST00000394689.2,ENST00000394688.3 |
| exon_skip_144294 | 16 | 50373886:50373997:50383933:50384078:50388335:50388390 | 50383933:50384078 | ENSG00000166164.11 | ENST00000475877.1,ENST00000394689.2,ENST00000394688.3 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for BRD7 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_144284 | 16 | 50354573:50354685:50355892:50355949:50357497:50357609 | 50355892:50355949 | ENSG00000166164.11 | ENST00000394688.3 |
| exon_skip_144286 | 16 | 50354573:50354688:50355892:50355949:50357497:50357609 | 50355892:50355949 | ENSG00000166164.11 | ENST00000394689.2 |
| exon_skip_144287 | 16 | 50355892:50355949:50357497:50357609:50359658:50359766 | 50357497:50357609 | ENSG00000166164.11 | ENST00000394688.3,ENST00000394689.2 |
| exon_skip_144289 | 16 | 50359658:50359794:50360194:50360302:50362579:50362655 | 50360194:50360302 | ENSG00000166164.11 | ENST00000394688.3,ENST00000394689.2 |
| exon_skip_144294 | 16 | 50373886:50373997:50383933:50384078:50388335:50388390 | 50383933:50384078 | ENSG00000166164.11 | ENST00000394688.3,ENST00000394689.2,ENST00000475877.1 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for BRD7 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000394688 | 50357497 | 50357609 | Frame-shift |
| ENST00000394688 | 50383933 | 50384078 | Frame-shift |
| ENST00000394688 | 50355892 | 50355949 | In-frame |
| ENST00000394688 | 50360194 | 50360302 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000394688 | 50357497 | 50357609 | Frame-shift |
| ENST00000394688 | 50383933 | 50384078 | Frame-shift |
| ENST00000394688 | 50355892 | 50355949 | In-frame |
| ENST00000394688 | 50360194 | 50360302 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for BRD7 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000394688 | 5387 | 651 | 50360194 | 50360302 | 1248 | 1355 | 362 | 398 |
| ENST00000394688 | 5387 | 651 | 50355892 | 50355949 | 1604 | 1660 | 481 | 500 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000394688 | 5387 | 651 | 50360194 | 50360302 | 1248 | 1355 | 362 | 398 |
| ENST00000394688 | 5387 | 651 | 50355892 | 50355949 | 1604 | 1660 | 481 | 500 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q9NPI1 | 362 | 398 | 1 | 651 | Chain | ID=PRO_0000227664;Note=Bromodomain-containing protein 7 |
| Q9NPI1 | 362 | 398 | 389 | 389 | Cross-link | Note=Glycyl lysine isopeptide (Lys-Gly) (interchain with G-Cter in SUMO2);Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:28112733;Dbxref=PMID:28112733 |
| Q9NPI1 | 362 | 398 | 380 | 380 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:23186163;Dbxref=PMID:23186163 |
| Q9NPI1 | 481 | 500 | 500 | 500 | Alternative sequence | ID=VSP_017564;Note=In isoform 2. E->EQ;Ontology_term=ECO:0000303,ECO:0000303;evidence=ECO:0000303|PubMed:11025449,ECO:0000303|PubMed:15489334;Dbxref=PMID:11025449,PMID:15489334 |
| Q9NPI1 | 481 | 500 | 1 | 651 | Chain | ID=PRO_0000227664;Note=Bromodomain-containing protein 7 |
| Q9NPI1 | 481 | 500 | 482 | 482 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000250;evidence=ECO:0000250|UniProtKB:O88665 |
| Q9NPI1 | 481 | 500 | 485 | 485 | Sequence conflict | Note=E->G;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q9NPI1 | 362 | 398 | 1 | 651 | Chain | ID=PRO_0000227664;Note=Bromodomain-containing protein 7 |
| Q9NPI1 | 362 | 398 | 389 | 389 | Cross-link | Note=Glycyl lysine isopeptide (Lys-Gly) (interchain with G-Cter in SUMO2);Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:28112733;Dbxref=PMID:28112733 |
| Q9NPI1 | 362 | 398 | 380 | 380 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:23186163;Dbxref=PMID:23186163 |
| Q9NPI1 | 481 | 500 | 500 | 500 | Alternative sequence | ID=VSP_017564;Note=In isoform 2. E->EQ;Ontology_term=ECO:0000303,ECO:0000303;evidence=ECO:0000303|PubMed:11025449,ECO:0000303|PubMed:15489334;Dbxref=PMID:11025449,PMID:15489334 |
| Q9NPI1 | 481 | 500 | 1 | 651 | Chain | ID=PRO_0000227664;Note=Bromodomain-containing protein 7 |
| Q9NPI1 | 481 | 500 | 482 | 482 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000250;evidence=ECO:0000250|UniProtKB:O88665 |
| Q9NPI1 | 481 | 500 | 485 | 485 | Sequence conflict | Note=E->G;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
Top |
SNVs in the skipped exons for BRD7 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
BRD7_COAD_exon_skip_144294_psi_boxplot.png |
BRD7_HNSC_exon_skip_144294_psi_boxplot.png |
BRD7_KIRC_exon_skip_144294_psi_boxplot.png |
BRD7_STAD_exon_skip_144294_psi_boxplot.png |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_144286 exon_skip_144284 | 50355893 | 50355949 | 50355902 | 50355902 | Frame_Shift_Del | T | - | p.K497fs |
| SKCM | TCGA-EE-A183-06 | exon_skip_144287 | 50357498 | 50357609 | 50357512 | 50357512 | Frame_Shift_Del | G | - | p.Q477fs |
| LIHC | TCGA-DD-AAD1-01 | exon_skip_144287 | 50357498 | 50357609 | 50357551 | 50357552 | Frame_Shift_Del | GT | - | p.464_464del |
| LIHC | TCGA-ED-A8O5-01 | exon_skip_144287 | 50357498 | 50357609 | 50357561 | 50357582 | Frame_Shift_Del | TGCCATGACATACGGATAATCT | - | p.454_461del |
| PCPG | TCGA-SA-A6C2-01 | exon_skip_144287 | 50357498 | 50357609 | 50357568 | 50357571 | Frame_Shift_Del | ACAT | - | p.YV457fs |
| ESCA | TCGA-L5-A4OF-01 | exon_skip_144287 | 50357498 | 50357609 | 50357595 | 50357595 | Frame_Shift_Del | A | - | p.L449fs |
| SKCM | TCGA-EE-A2GN-06 | exon_skip_144287 | 50357498 | 50357609 | 50357594 | 50357595 | Frame_Shift_Ins | - | A | p.C449fs |
| SKCM | TCGA-EE-A2GN-06 | exon_skip_144287 | 50357498 | 50357609 | 50357594 | 50357595 | Frame_Shift_Ins | - | A | p.L449fs |
| KIRC | TCGA-B0-5102-01 | exon_skip_144294 | 50383934 | 50384078 | 50383993 | 50383994 | Frame_Shift_Ins | - | AC | p.D*177fs |
| KIRC | TCGA-B0-5102-01 | exon_skip_144294 | 50383934 | 50384078 | 50383993 | 50383994 | Frame_Shift_Ins | - | AC | p.F178fs |
| SARC | TCGA-DX-A8BT-01 | exon_skip_144287 | 50357498 | 50357609 | 50357503 | 50357503 | Nonsense_Mutation | C | A | p.E480* |
| SKCM | TCGA-EB-A44O-01 | exon_skip_144287 | 50357498 | 50357609 | 50357541 | 50357541 | Nonsense_Mutation | A | C | p.L467* |
| SKCM | TCGA-EB-A44O-01 | exon_skip_144287 | 50357498 | 50357609 | 50357541 | 50357541 | Nonsense_Mutation | A | C | p.L467X |
| LIHC | TCGA-G3-A3CH-01 | exon_skip_144287 | 50357498 | 50357609 | 50357553 | 50357553 | Nonsense_Mutation | A | T | p.L463* |
| LIHC | TCGA-G3-A3CH-01 | exon_skip_144287 | 50357498 | 50357609 | 50357553 | 50357553 | Nonsense_Mutation | A | T | p.L463X |
| LIHC | TCGA-DD-A1EH-01 | exon_skip_144287 | 50357498 | 50357609 | 50357576 | 50357576 | Nonsense_Mutation | A | C | p.Y455* |
| LIHC | TCGA-DD-A1EH-01 | exon_skip_144287 | 50357498 | 50357609 | 50357576 | 50357576 | Nonsense_Mutation | A | C | p.Y455X |
| THYM | TCGA-XU-A933-01 | exon_skip_144287 | 50357498 | 50357609 | 50357576 | 50357576 | Nonsense_Mutation | A | C | p.Y455* |
| THYM | TCGA-XU-A933-01 | exon_skip_144287 | 50357498 | 50357609 | 50357576 | 50357576 | Nonsense_Mutation | A | C | p.Y455X |
| SKCM | TCGA-D3-A1Q9-06 | exon_skip_144287 | 50357498 | 50357609 | 50357602 | 50357602 | Nonsense_Mutation | C | A | p.E447* |
| SKCM | TCGA-D3-A1Q9-06 | exon_skip_144287 | 50357498 | 50357609 | 50357602 | 50357602 | Nonsense_Mutation | C | A | p.E447X |
| HNSC | TCGA-CV-A6K2-01 | exon_skip_144294 | 50383934 | 50384078 | 50383954 | 50383954 | Nonsense_Mutation | G | A | p.Q191* |
| COAD | TCGA-CM-6166-01 | exon_skip_144294 | 50383934 | 50384078 | 50383933 | 50383933 | Splice_Site | C | T | . |
| STAD | TCGA-BR-8680-01 | exon_skip_144294 | 50383934 | 50384078 | 50384079 | 50384079 | Splice_Site | C | A | . |
| STAD | TCGA-BR-8680-01 | exon_skip_144294 | 50383934 | 50384078 | 50384079 | 50384079 | Splice_Site | C | A | p.R149_splice |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
 | Sample: TCGA-CM-6166-01 |
| Cancer type: COAD | |
| ESID: exon_skip_144294 | |
| Skipped exon start: 50383934 | |
| Skipped exon end: 50384078 | |
| Mutation start: 50383933 | |
| Mutation end: 50383933 | |
| Mutation type: Splice_Site | |
| Reference seq: C | |
| Mutation seq: T | |
| AAchange: . | |
exon_skip_144294_COAD_TCGA-CM-6166-01.png | |
 | Sample: TCGA-BR-8680-01 |
| Cancer type: STAD | |
| ESID: exon_skip_144294 | |
| Skipped exon start: 50383934 | |
| Skipped exon end: 50384078 | |
| Mutation start: 50384079 | |
| Mutation end: 50384079 | |
| Mutation type: Splice_Site | |
| Reference seq: C | |
| Mutation seq: A | |
| AAchange: . | |
| Sample: TCGA-BR-8680-01 |
| Cancer type: STAD | |
| ESID: exon_skip_144294 | |
| Skipped exon start: 50383934 | |
| Skipped exon end: 50384078 | |
| Mutation start: 50384079 | |
| Mutation end: 50384079 | |
| Mutation type: Splice_Site | |
| Reference seq: C | |
| Mutation seq: A | |
| AAchange: p.R149_splice | |
exon_skip_106946_STAD_TCGA-BR-8680-01.png | |
exon_skip_107215_STAD_TCGA-BR-8680-01.png | |
exon_skip_122567_STAD_TCGA-BR-8680-01.png | |
exon_skip_122573_STAD_TCGA-BR-8680-01.png | |
exon_skip_144294_STAD_TCGA-BR-8680-01.png | |
exon_skip_26878_STAD_TCGA-BR-8680-01.png | |
exon_skip_30156_STAD_TCGA-BR-8680-01.png | |
exon_skip_324648_STAD_TCGA-BR-8680-01.png | |
exon_skip_326437_STAD_TCGA-BR-8680-01.png | |
exon_skip_326558_STAD_TCGA-BR-8680-01.png | |
exon_skip_326569_STAD_TCGA-BR-8680-01.png | |
exon_skip_328488_STAD_TCGA-BR-8680-01.png | |
exon_skip_335090_STAD_TCGA-BR-8680-01.png | |
exon_skip_389166_STAD_TCGA-BR-8680-01.png | |
exon_skip_40432_STAD_TCGA-BR-8680-01.png | |
exon_skip_40460_STAD_TCGA-BR-8680-01.png | |
exon_skip_40461_STAD_TCGA-BR-8680-01.png | |
exon_skip_436498_STAD_TCGA-BR-8680-01.png | |
exon_skip_466512_STAD_TCGA-BR-8680-01.png | |
exon_skip_478774_STAD_TCGA-BR-8680-01.png | |
exon_skip_484956_STAD_TCGA-BR-8680-01.png | |
exon_skip_64135_STAD_TCGA-BR-8680-01.png | |
exon_skip_64136_STAD_TCGA-BR-8680-01.png | |
exon_skip_64137_STAD_TCGA-BR-8680-01.png | |
exon_skip_69365_STAD_TCGA-BR-8680-01.png | |
exon_skip_69375_STAD_TCGA-BR-8680-01.png | |
exon_skip_75101_STAD_TCGA-BR-8680-01.png | |
 | Sample: TCGA-B0-5102-01 |
| Cancer type: KIRC | |
| ESID: exon_skip_144294 | |
| Skipped exon start: 50383934 | |
| Skipped exon end: 50384078 | |
| Mutation start: 50383993 | |
| Mutation end: 50383994 | |
| Mutation type: Frame_Shift_Ins | |
| Reference seq: - | |
| Mutation seq: AC | |
| AAchange: p.F178fs | |
| Sample: TCGA-B0-5102-01 |
| Cancer type: KIRC | |
| ESID: exon_skip_144294 | |
| Skipped exon start: 50383934 | |
| Skipped exon end: 50384078 | |
| Mutation start: 50383993 | |
| Mutation end: 50383994 | |
| Mutation type: Frame_Shift_Ins | |
| Reference seq: - | |
| Mutation seq: AC | |
| AAchange: p.D*177fs | |
exon_skip_144294_KIRC_TCGA-B0-5102-01.png | |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| NCIH1155_LUNG | 50355893 | 50355949 | 50355906 | 50355906 | Missense_Mutation | G | A | p.A496V |
| SNU81_LARGE_INTESTINE | 50355893 | 50355949 | 50355946 | 50355946 | Missense_Mutation | A | C | p.L483V |
| OVK18_OVARY | 50357498 | 50357609 | 50357538 | 50357538 | Missense_Mutation | G | A | p.T468I |
| HCC2998_LARGE_INTESTINE | 50357498 | 50357609 | 50357575 | 50357575 | Missense_Mutation | G | A | p.P456S |
| KE39_STOMACH | 50357498 | 50357609 | 50357581 | 50357581 | Missense_Mutation | C | T | p.D454N |
| RL952_ENDOMETRIUM | 50357498 | 50357609 | 50357592 | 50357592 | Missense_Mutation | G | C | p.A450G |
| RL_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 50360195 | 50360302 | 50360218 | 50360218 | Missense_Mutation | T | C | p.D391G |
| LN428_CENTRAL_NERVOUS_SYSTEM | 50383934 | 50384078 | 50383973 | 50383973 | Missense_Mutation | C | A | p.K184N |
| HCT15_LARGE_INTESTINE | 50383934 | 50384078 | 50384032 | 50384032 | Missense_Mutation | C | T | p.A165T |
| COLO678_LARGE_INTESTINE | 50383934 | 50384078 | 50384021 | 50384021 | Nonsense_Mutation | G | T | p.Y168* |
| NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 50383934 | 50384078 | 50384021 | 50384021 | Nonsense_Mutation | G | T | p.Y168* |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for BRD7 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for BRD7 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for BRD7 |
Top |
RelatedDrugs for BRD7 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for BRD7 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|