|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for DAZAP1 |
 Gene summary |
| Gene information | Gene symbol | DAZAP1 | Gene ID | 26528 |
| Gene name | DAZ associated protein 1 | |
| Synonyms | - | |
| Cytomap | 19p13.3 | |
| Type of gene | protein-coding | |
| Description | DAZ-associated protein 1deleted in azoospermia-associated protein 1testicular tissue protein Li 50 | |
| Modification date | 20180523 | |
| UniProtAcc | Q96EP5 | |
| Context | PubMed: DAZAP1 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for DAZAP1 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for DAZAP1 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for DAZAP1 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_300626 | 19 | 1407733:1407801:1416455:1416554:1417498:1417539 | 1416455:1416554 | ENSG00000071626.12 | ENST00000592522.1 |
| exon_skip_300645 | 19 | 1417498:1417539:1418202:1418369:1418664:1418708 | 1418202:1418369 | ENSG00000071626.12 | ENST00000336761.6,ENST00000590419.1,ENST00000592522.1,ENST00000589484.1,ENST00000586579.1,ENST00000233078.4,ENST00000587833.1 |
| exon_skip_300652 | 19 | 1418202:1418369:1418664:1418730:1421146:1421231 | 1418664:1418730 | ENSG00000071626.12 | ENST00000336761.6,ENST00000589484.1,ENST00000233078.4,ENST00000587833.1 |
| exon_skip_300653 | 19 | 1418202:1418369:1418664:1418730:1421149:1421257 | 1418664:1418730 | ENSG00000071626.12 | ENST00000592522.1,ENST00000586579.1 |
| exon_skip_300658 | 19 | 1421149:1421257:1422346:1422395:1428840:1428902 | 1422346:1422395 | ENSG00000071626.12 | ENST00000589484.1,ENST00000586579.1 |
| exon_skip_300663 | 19 | 1422346:1422395:1425876:1425959:1428840:1428900 | 1425876:1425959 | ENSG00000071626.12 | ENST00000336761.6,ENST00000233078.4,ENST00000592453.1 |
| exon_skip_300665 | 19 | 1422346:1422395:1428840:1428994:1429965:1429995 | 1428840:1428994 | ENSG00000071626.12 | ENST00000589484.1 |
| exon_skip_300674 | 19 | 1428895:1428994:1429965:1429995:1430220:1430361 | 1429965:1429995 | ENSG00000071626.12 | ENST00000336761.6,ENST00000585485.1,ENST00000589484.1,ENST00000587079.1,ENST00000233078.4 |
| exon_skip_300676 | 19 | 1429965:1429995:1430220:1430361:1432512:1432680 | 1430220:1430361 | ENSG00000071626.12 | ENST00000336761.6,ENST00000585485.1,ENST00000589484.1,ENST00000587079.1,ENST00000233078.4 |
| exon_skip_300679 | 19 | 1432512:1432689:1433737:1433826:1434735:1435680 | 1433737:1433826 | ENSG00000071626.12 | ENST00000336761.6 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for DAZAP1 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_300626 | 19 | 1407733:1407801:1416455:1416554:1417498:1417539 | 1416455:1416554 | ENSG00000071626.12 | ENST00000592522.1 |
| exon_skip_300645 | 19 | 1417498:1417539:1418202:1418369:1418664:1418708 | 1418202:1418369 | ENSG00000071626.12 | ENST00000336761.6,ENST00000233078.4,ENST00000586579.1,ENST00000592522.1,ENST00000590419.1,ENST00000587833.1,ENST00000589484.1 |
| exon_skip_300646 | 19 | 1417498:1417539:1418202:1418369:1421146:1421231 | 1418202:1418369 | ENSG00000071626.12 | ENST00000592453.1 |
| exon_skip_300652 | 19 | 1418202:1418369:1418664:1418730:1421146:1421231 | 1418664:1418730 | ENSG00000071626.12 | ENST00000336761.6,ENST00000233078.4,ENST00000587833.1,ENST00000589484.1 |
| exon_skip_300653 | 19 | 1418202:1418369:1418664:1418730:1421149:1421257 | 1418664:1418730 | ENSG00000071626.12 | ENST00000586579.1,ENST00000592522.1 |
| exon_skip_300658 | 19 | 1421149:1421257:1422346:1422395:1428840:1428902 | 1422346:1422395 | ENSG00000071626.12 | ENST00000586579.1,ENST00000589484.1 |
| exon_skip_300663 | 19 | 1422346:1422395:1425876:1425959:1428840:1428900 | 1425876:1425959 | ENSG00000071626.12 | ENST00000336761.6,ENST00000233078.4,ENST00000592453.1 |
| exon_skip_300665 | 19 | 1422346:1422395:1428840:1428994:1429965:1429995 | 1428840:1428994 | ENSG00000071626.12 | ENST00000589484.1 |
| exon_skip_300674 | 19 | 1428895:1428994:1429965:1429995:1430220:1430361 | 1429965:1429995 | ENSG00000071626.12 | ENST00000336761.6,ENST00000233078.4,ENST00000589484.1,ENST00000585485.1,ENST00000587079.1 |
| exon_skip_300676 | 19 | 1429965:1429995:1430220:1430361:1432512:1432680 | 1430220:1430361 | ENSG00000071626.12 | ENST00000336761.6,ENST00000233078.4,ENST00000589484.1,ENST00000585485.1,ENST00000587079.1 |
| exon_skip_300679 | 19 | 1432512:1432689:1433737:1433826:1434735:1435680 | 1433737:1433826 | ENSG00000071626.12 | ENST00000336761.6 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for DAZAP1 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000233078 | 1418202 | 1418369 | Frame-shift |
| ENST00000233078 | 1425876 | 1425959 | Frame-shift |
| ENST00000233078 | 1418664 | 1418730 | In-frame |
| ENST00000233078 | 1429965 | 1429995 | In-frame |
| ENST00000233078 | 1430220 | 1430361 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000233078 | 1418202 | 1418369 | Frame-shift |
| ENST00000233078 | 1425876 | 1425959 | Frame-shift |
| ENST00000233078 | 1418664 | 1418730 | In-frame |
| ENST00000233078 | 1429965 | 1429995 | In-frame |
| ENST00000233078 | 1430220 | 1430361 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for DAZAP1 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000233078 | 2177 | 407 | 1418664 | 1418730 | 399 | 464 | 79 | 101 |
| ENST00000233078 | 2177 | 407 | 1429965 | 1429995 | 862 | 891 | 233 | 243 |
| ENST00000233078 | 2177 | 407 | 1430220 | 1430361 | 892 | 1032 | 243 | 290 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000233078 | 2177 | 407 | 1418664 | 1418730 | 399 | 464 | 79 | 101 |
| ENST00000233078 | 2177 | 407 | 1429965 | 1429995 | 862 | 891 | 233 | 243 |
| ENST00000233078 | 2177 | 407 | 1430220 | 1430361 | 892 | 1032 | 243 | 290 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q96EP5 | 79 | 101 | 78 | 81 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2DH8 |
| Q96EP5 | 79 | 101 | 1 | 407 | Chain | ID=PRO_0000081565;Note=DAZ-associated protein 1 |
| Q96EP5 | 79 | 101 | 10 | 97 | Domain | Note=RRM 1;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00176 |
| Q96EP5 | 233 | 243 | 1 | 407 | Chain | ID=PRO_0000081565;Note=DAZ-associated protein 1 |
| Q96EP5 | 233 | 243 | 222 | 385 | Compositional bias | Note=Pro-rich |
| Q96EP5 | 243 | 290 | 1 | 407 | Chain | ID=PRO_0000081565;Note=DAZ-associated protein 1 |
| Q96EP5 | 243 | 290 | 222 | 385 | Compositional bias | Note=Pro-rich |
| Q96EP5 | 243 | 290 | 253 | 253 | Modified residue | Note=Omega-N-methylarginine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:24129315;Dbxref=PMID:24129315 |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q96EP5 | 79 | 101 | 78 | 81 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2DH8 |
| Q96EP5 | 79 | 101 | 1 | 407 | Chain | ID=PRO_0000081565;Note=DAZ-associated protein 1 |
| Q96EP5 | 79 | 101 | 10 | 97 | Domain | Note=RRM 1;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00176 |
| Q96EP5 | 233 | 243 | 1 | 407 | Chain | ID=PRO_0000081565;Note=DAZ-associated protein 1 |
| Q96EP5 | 233 | 243 | 222 | 385 | Compositional bias | Note=Pro-rich |
| Q96EP5 | 243 | 290 | 1 | 407 | Chain | ID=PRO_0000081565;Note=DAZ-associated protein 1 |
| Q96EP5 | 243 | 290 | 222 | 385 | Compositional bias | Note=Pro-rich |
| Q96EP5 | 243 | 290 | 253 | 253 | Modified residue | Note=Omega-N-methylarginine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:24129315;Dbxref=PMID:24129315 |
Top |
SNVs in the skipped exons for DAZAP1 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
DAZAP1_CHOL_exon_skip_300665_psi_boxplot.png |
DAZAP1_COAD_exon_skip_300676_psi_boxplot.png |
DAZAP1_LIHC_exon_skip_300676_psi_boxplot.png |
DAZAP1_STAD_exon_skip_300676_psi_boxplot.png |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_300653 exon_skip_300652 | 1418665 | 1418730 | 1418670 | 1418670 | Frame_Shift_Del | C | - | p.D81fs |
| COAD | TCGA-G4-6588-01 | exon_skip_300653 exon_skip_300652 | 1418665 | 1418730 | 1418690 | 1418690 | Frame_Shift_Del | G | - | p.R88fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_300658 | 1422347 | 1422395 | 1422375 | 1422375 | Frame_Shift_Del | C | - | p.A148fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_300663 | 1425877 | 1425959 | 1425954 | 1425954 | Frame_Shift_Del | A | - | p.K182fs |
| CHOL | TCGA-W5-AA39-01 | exon_skip_300665 | 1428841 | 1428994 | 1428934 | 1428956 | Frame_Shift_Del | GCTGCCAATGGCTGGGCAGGCCA | - | p.213_221del |
| CHOL | TCGA-W5-AA39-01 | exon_skip_300665 | 1428841 | 1428994 | 1428934 | 1428956 | Frame_Shift_Del | GCTGCCAATGGCTGGGCAGGCCA | - | p.AANGWAGQ214fs |
| KIRP | TCGA-MH-A856-01 | exon_skip_300665 | 1428841 | 1428994 | 1428952 | 1428953 | Frame_Shift_Del | GG | - | p.219_220del |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_300676 | 1430221 | 1430361 | 1430235 | 1430235 | Frame_Shift_Del | C | - | p.P250fs |
| COAD | TCGA-A6-6781-01 | exon_skip_300676 | 1430221 | 1430361 | 1430254 | 1430254 | Frame_Shift_Del | C | - | p.A255fs |
| COAD | TCGA-AD-6895-01 | exon_skip_300676 | 1430221 | 1430361 | 1430254 | 1430254 | Frame_Shift_Del | C | - | p.A255fs |
| STAD | TCGA-BR-4361-01 | exon_skip_300676 | 1430221 | 1430361 | 1430254 | 1430254 | Frame_Shift_Del | C | - | p.A255fs |
| STAD | TCGA-BR-8487-01 | exon_skip_300676 | 1430221 | 1430361 | 1430254 | 1430254 | Frame_Shift_Del | C | - | p.A255fs |
| STAD | TCGA-CG-4442-01 | exon_skip_300676 | 1430221 | 1430361 | 1430254 | 1430254 | Frame_Shift_Del | C | - | p.A255fs |
| STAD | TCGA-D7-A6EY-01 | exon_skip_300676 | 1430221 | 1430361 | 1430254 | 1430254 | Frame_Shift_Del | C | - | p.A255fs |
| STAD | TCGA-HU-A4G9-01 | exon_skip_300676 | 1430221 | 1430361 | 1430254 | 1430254 | Frame_Shift_Del | C | - | p.A255fs |
| UCEC | TCGA-A5-A0GB-01 | exon_skip_300676 | 1430221 | 1430361 | 1430254 | 1430254 | Frame_Shift_Del | C | - | p.A255fs |
| UCEC | TCGA-AP-A0LE-01 | exon_skip_300676 | 1430221 | 1430361 | 1430254 | 1430254 | Frame_Shift_Del | C | - | p.A255fs |
| UCEC | TCGA-BS-A0U8-01 | exon_skip_300676 | 1430221 | 1430361 | 1430254 | 1430254 | Frame_Shift_Del | C | - | p.A255fs |
| UCEC | TCGA-BS-A0UL-01 | exon_skip_300676 | 1430221 | 1430361 | 1430254 | 1430254 | Frame_Shift_Del | C | - | p.A255fs |
| COAD | TCGA-AU-6004-01 | exon_skip_300676 | 1430221 | 1430361 | 1430253 | 1430254 | Frame_Shift_Ins | - | C | p.A255fs |
| LIHC | TCGA-2Y-A9H0-01 | exon_skip_300674 | 1429966 | 1429995 | 1429964 | 1429964 | Splice_Site | A | C | . |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
 | Sample: TCGA-AU-6004-01 |
| Cancer type: COAD | |
| ESID: exon_skip_300676 | |
| Skipped exon start: 1430221 | |
| Skipped exon end: 1430361 | |
| Mutation start: 1430253 | |
| Mutation end: 1430254 | |
| Mutation type: Frame_Shift_Ins | |
| Reference seq: - | |
| Mutation seq: C | |
| AAchange: p.A255fs | |
exon_skip_121002_COAD_TCGA-AU-6004-01.png | |
exon_skip_137953_COAD_TCGA-AU-6004-01.png | |
exon_skip_300676_COAD_TCGA-AU-6004-01.png | |
exon_skip_336630_COAD_TCGA-AU-6004-01.png | |
exon_skip_422717_COAD_TCGA-AU-6004-01.png | |
exon_skip_434040_COAD_TCGA-AU-6004-01.png | |
exon_skip_454598_COAD_TCGA-AU-6004-01.png | |
exon_skip_55853_COAD_TCGA-AU-6004-01.png | |
 | Sample: TCGA-AD-6895-01 |
| Cancer type: COAD | |
| ESID: exon_skip_300676 | |
| Skipped exon start: 1430221 | |
| Skipped exon end: 1430361 | |
| Mutation start: 1430254 | |
| Mutation end: 1430254 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: C | |
| Mutation seq: - | |
| AAchange: p.A255fs | |
exon_skip_300676_COAD_TCGA-AD-6895-01.png | |
exon_skip_313784_COAD_TCGA-AD-6895-01.png | |
exon_skip_319638_COAD_TCGA-AD-6895-01.png | |
exon_skip_322202_COAD_TCGA-AD-6895-01.png | |
exon_skip_370500_COAD_TCGA-AD-6895-01.png | |
exon_skip_370501_COAD_TCGA-AD-6895-01.png | |
exon_skip_370503_COAD_TCGA-AD-6895-01.png | |
exon_skip_439050_COAD_TCGA-AD-6895-01.png | |
exon_skip_56683_COAD_TCGA-AD-6895-01.png | |
 | Sample: TCGA-G3-A3CJ-01 |
| Cancer type: LIHC | |
| ESID: exon_skip_300652 | |
| Skipped exon start: 1418665 | |
| Skipped exon end: 1418730 | |
| Mutation start: 1418670 | |
| Mutation end: 1418670 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: C | |
| Mutation seq: - | |
| AAchange: p.D81fs | |
| Sample: TCGA-G3-A3CJ-01 |
| Cancer type: LIHC | |
| ESID: exon_skip_300658 | |
| Skipped exon start: 1422347 | |
| Skipped exon end: 1422395 | |
| Mutation start: 1422375 | |
| Mutation end: 1422375 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: C | |
| Mutation seq: - | |
| AAchange: p.A148fs | |
| Sample: TCGA-G3-A3CJ-01 |
| Cancer type: LIHC | |
| ESID: exon_skip_300676 | |
| Skipped exon start: 1430221 | |
| Skipped exon end: 1430361 | |
| Mutation start: 1430235 | |
| Mutation end: 1430235 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: C | |
| Mutation seq: - | |
| AAchange: p.P250fs | |
exon_skip_101516_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_106378_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_106524_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_109529_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_109778_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_11286_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_11289_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_11349_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_113894_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_113898_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_11611_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_11615_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_11638_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_11641_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_11926_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_11933_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_11937_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_11939_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_124065_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_124066_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_124693_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_126824_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_126833_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_126836_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_1268_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_1270_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_127101_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_1274_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_128729_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_129795_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_129799_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_131401_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_131474_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_135545_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_135553_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_13626_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_138373_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_138676_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_141657_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_143515_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_143728_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_14564_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_149490_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_153354_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_1873_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_1874_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_24442_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_284510_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_289275_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_289905_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_291218_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_293221_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_293223_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_300058_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_300676_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_302253_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_302693_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_305815_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_30789_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_30792_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_309404_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_309486_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_309505_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_309539_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_311823_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_313290_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_315285_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_315286_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_316122_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_325693_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_327441_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_327550_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_329666_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_329933_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_331517_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_354387_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_354396_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_356468_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_365019_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_365023_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_371589_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_375393_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_380574_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_382000_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_382738_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_385031_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_387684_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_421130_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_421131_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_421134_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_426528_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_426530_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_427391_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_430528_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_433436_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_433655_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_434375_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_43567_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_436327_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_436618_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_444593_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_445559_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_447600_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_452739_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_4535_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_457245_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_45824_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_464169_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_464999_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_466343_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_467017_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_468347_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_470485_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_478117_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_483502_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_483618_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_483622_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_492152_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_499409_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_502144_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_504288_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_504556_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_506095_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_506097_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_507316_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_507513_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_55516_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_57597_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_57603_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_5818_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_5861_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_58894_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_59476_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_60476_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_67293_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_67402_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_69019_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_71100_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_73796_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_84528_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_86050_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_86051_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_86135_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_87721_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_93891_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_94866_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_96453_LIHC_TCGA-G3-A3CJ-01.png | |
exon_skip_98550_LIHC_TCGA-G3-A3CJ-01.png | |
 | Sample: TCGA-AP-A0LE-01 |
| Cancer type: UCEC | |
| ESID: exon_skip_300676 | |
| Skipped exon start: 1430221 | |
| Skipped exon end: 1430361 | |
| Mutation start: 1430254 | |
| Mutation end: 1430254 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: C | |
| Mutation seq: - | |
| AAchange: p.A255fs | |
exon_skip_300676_UCEC_TCGA-AP-A0LE-01.png | |
 | Sample: TCGA-BS-A0U8-01 |
| Cancer type: UCEC | |
| ESID: exon_skip_300676 | |
| Skipped exon start: 1430221 | |
| Skipped exon end: 1430361 | |
| Mutation start: 1430254 | |
| Mutation end: 1430254 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: C | |
| Mutation seq: - | |
| AAchange: p.A255fs | |
exon_skip_153742_UCEC_TCGA-BS-A0U8-01.png | |
exon_skip_300676_UCEC_TCGA-BS-A0U8-01.png | |
 | Sample: TCGA-BS-A0UL-01 |
| Cancer type: UCEC | |
| ESID: exon_skip_300676 | |
| Skipped exon start: 1430221 | |
| Skipped exon end: 1430361 | |
| Mutation start: 1430254 | |
| Mutation end: 1430254 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: C | |
| Mutation seq: - | |
| AAchange: p.A255fs | |
exon_skip_300676_UCEC_TCGA-BS-A0UL-01.png | |
 | Sample: TCGA-W5-AA39-01 |
| Cancer type: CHOL | |
| ESID: exon_skip_300665 | |
| Skipped exon start: 1428841 | |
| Skipped exon end: 1428994 | |
| Mutation start: 1428934 | |
| Mutation end: 1428956 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: GCTGCCAATGGCTGGGCAGGCCA | |
| Mutation seq: - | |
| AAchange: p.AANGWAGQ214fs | |
| Sample: TCGA-W5-AA39-01 |
| Cancer type: CHOL | |
| ESID: exon_skip_300665 | |
| Skipped exon start: 1428841 | |
| Skipped exon end: 1428994 | |
| Mutation start: 1428934 | |
| Mutation end: 1428956 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: GCTGCCAATGGCTGGGCAGGCCA | |
| Mutation seq: - | |
| AAchange: p.213_221del | |
exon_skip_148507_CHOL_TCGA-W5-AA39-01.png | |
exon_skip_26206_CHOL_TCGA-W5-AA39-01.png | |
exon_skip_300665_CHOL_TCGA-W5-AA39-01.png | |
exon_skip_94118_CHOL_TCGA-W5-AA39-01.png | |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| JURKAT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 1418203 | 1418369 | 1418323 | 1418323 | Frame_Shift_Del | T | - | p.V64fs |
| PACADD137_PANCREAS | 1430221 | 1430361 | 1430254 | 1430254 | Frame_Shift_Del | C | - | p.A255fs |
| HEC59_ENDOMETRIUM | 1430221 | 1430361 | 1430254 | 1430254 | Frame_Shift_Del | C | - | p.A255fs |
| JHUEM2_ENDOMETRIUM | 1430221 | 1430361 | 1430254 | 1430254 | Frame_Shift_Del | C | - | p.A255fs |
| JURKAT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 1430221 | 1430361 | 1430254 | 1430254 | Frame_Shift_Del | C | - | p.A255fs |
| MFE296_ENDOMETRIUM | 1430221 | 1430361 | 1430254 | 1430254 | Frame_Shift_Del | C | - | p.A255fs |
| SNGM_ENDOMETRIUM | 1430221 | 1430361 | 1430254 | 1430254 | Frame_Shift_Del | C | - | p.A255fs |
| SUPHD1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 1430221 | 1430361 | 1430254 | 1430254 | Frame_Shift_Del | C | - | p.A255fs |
| SW48_LARGE_INTESTINE | 1430221 | 1430361 | 1430254 | 1430254 | Frame_Shift_Del | C | - | p.A255fs |
| MOLT3_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 1425877 | 1425959 | 1425953 | 1425954 | Frame_Shift_Ins | - | A | p.K181fs |
| A172_CENTRAL_NERVOUS_SYSTEM | 1425877 | 1425959 | 1425953 | 1425954 | Frame_Shift_Ins | - | A | p.K181fs |
| HCC364_LUNG | 1425877 | 1425959 | 1425953 | 1425954 | Frame_Shift_Ins | - | A | p.K181fs |
| MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 1428841 | 1428994 | 1428910 | 1428911 | Frame_Shift_Ins | - | G | p.W206fs |
| C125PM_LARGE_INTESTINE | 1430221 | 1430361 | 1430252 | 1430253 | Frame_Shift_Ins | - | G | p.A255fs |
| GBM001_CENTRAL_NERVOUS_SYSTEM | 1430221 | 1430361 | 1430252 | 1430253 | Frame_Shift_Ins | - | G | p.A255fs |
| MCC13_SKIN | 1430221 | 1430361 | 1430252 | 1430253 | Frame_Shift_Ins | - | G | p.A255fs |
| NCIH2882_LUNG | 1430221 | 1430361 | 1430252 | 1430253 | Frame_Shift_Ins | - | G | p.A255fs |
| PC9_LUNG | 1430221 | 1430361 | 1430252 | 1430253 | Frame_Shift_Ins | - | G | p.A255fs |
| MDAPCA2B_PROSTATE | 1430221 | 1430361 | 1430253 | 1430254 | Frame_Shift_Ins | - | C | p.A255fs |
| CCK81_LARGE_INTESTINE | 1430221 | 1430361 | 1430253 | 1430254 | Frame_Shift_Ins | - | C | p.A255fs |
| COLO684_ENDOMETRIUM | 1430221 | 1430361 | 1430346 | 1430347 | Frame_Shift_Ins | - | C | p.A286fs |
| SW756_CERVIX | 1418203 | 1418369 | 1418258 | 1418258 | Missense_Mutation | G | A | p.M42I |
| DV90_LUNG | 1418203 | 1418369 | 1418268 | 1418268 | Missense_Mutation | A | G | p.T46A |
| SNU81_LARGE_INTESTINE | 1418203 | 1418369 | 1418365 | 1418365 | Missense_Mutation | G | A | p.R78Q |
| SNU175_LARGE_INTESTINE | 1418665 | 1418730 | 1418668 | 1418668 | Missense_Mutation | G | A | p.D81N |
| BCP1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 1422347 | 1422395 | 1422377 | 1422377 | Missense_Mutation | G | C | p.E149Q |
| MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 1425877 | 1425959 | 1425903 | 1425903 | Missense_Mutation | G | A | p.E164K |
| NCIH740_LUNG | 1425877 | 1425959 | 1425920 | 1425920 | Missense_Mutation | G | T | p.Q169H |
| SU8686_PANCREAS | 1428841 | 1428994 | 1428887 | 1428887 | Missense_Mutation | C | T | p.P198L |
| KM12_LARGE_INTESTINE | 1428841 | 1428994 | 1428896 | 1428896 | Missense_Mutation | C | T | p.P201L |
| DND41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 1428841 | 1428994 | 1428919 | 1428919 | Missense_Mutation | C | T | p.R209W |
| JURKAT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 1428841 | 1428994 | 1428934 | 1428934 | Missense_Mutation | G | A | p.A214T |
| OCUBM_BREAST | 1428841 | 1428994 | 1428983 | 1428983 | Missense_Mutation | A | G | p.Y230C |
| FUOV1_OVARY | 1430221 | 1430361 | 1430235 | 1430235 | Missense_Mutation | C | A | p.P249T |
| SBC1_LUNG | 1430221 | 1430361 | 1430235 | 1430235 | Missense_Mutation | C | A | p.P249T |
| MFE319_ENDOMETRIUM | 1430221 | 1430361 | 1430250 | 1430250 | Missense_Mutation | G | A | p.G254R |
| NCIH660_PROSTATE | 1430221 | 1430361 | 1430253 | 1430253 | Missense_Mutation | G | C | p.A255P |
| MFE319_ENDOMETRIUM | 1430221 | 1430361 | 1430325 | 1430325 | Missense_Mutation | G | A | p.G279S |
| HCC827GR5_LUNG | 1430221 | 1430361 | 1430347 | 1430347 | Missense_Mutation | C | A | p.A286D |
| SNU520_STOMACH | 1429966 | 1429995 | 1429994 | 1429994 | Splice_Site | T | C | p.I243I |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for DAZAP1 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for DAZAP1 |
 |
 |
 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for DAZAP1 |
Top |
RelatedDrugs for DAZAP1 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for DAZAP1 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| DAZAP1 | C0005586 | Bipolar Disorder | 1 | PSYGENET |
| DAZAP1 | C0036341 | Schizophrenia | 1 | PSYGENET |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|