|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for DHRS7B |
 Gene summary |
| Gene information | Gene symbol | DHRS7B | Gene ID | 25979 |
| Gene name | dehydrogenase/reductase 7B | |
| Synonyms | CGI-93|SDR32C1 | |
| Cytomap | 17p11.2 | |
| Type of gene | protein-coding | |
| Description | dehydrogenase/reductase SDR family member 7Bdehydrogenase/reductase (SDR family) member 7Bshort-chain dehydrogenase/reductase family 32C member 1 | |
| Modification date | 20180523 | |
| UniProtAcc | Q6IAN0 | |
| Context | PubMed: DHRS7B [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for DHRS7B from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for DHRS7B |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for DHRS7B |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_150057 | 17 | 21030267:21030304:21075330:21075509:21081545:21081655 | 21075330:21075509 | ENSG00000109016.13 | ENST00000582161.1,ENST00000395511.3 |
| exon_skip_150058 | 17 | 21030267:21030304:21075330:21075509:21086906:21086976 | 21075330:21075509 | ENSG00000109016.13 | ENST00000578426.1 |
| exon_skip_150064 | 17 | 21075334:21075509:21081545:21081655:21086906:21086976 | 21081545:21081655 | ENSG00000109016.13 | ENST00000582161.1,ENST00000395511.3,ENST00000579303.1,ENST00000346603.4 |
| exon_skip_150065 | 17 | 21087046:21087123:21087683:21087776:21092023:21092168 | 21087683:21087776 | ENSG00000109016.13 | ENST00000395511.3,ENST00000578426.1,ENST00000579303.1,ENST00000346603.4 |
| exon_skip_150066 | 17 | 21087046:21087123:21087683:21087776:21094260:21094579 | 21087683:21087776 | ENSG00000109016.13 | ENST00000583388.1 |
| exon_skip_150070 | 17 | 21087697:21087776:21092023:21092176:21094260:21094579 | 21092023:21092176 | ENSG00000109016.13 | ENST00000395511.3,ENST00000578426.1,ENST00000579303.1,ENST00000346603.4 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for DHRS7B |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_150058 | 17 | 21030267:21030304:21075330:21075509:21086906:21086976 | 21075330:21075509 | ENSG00000109016.13 | ENST00000578426.1 |
| exon_skip_150064 | 17 | 21075334:21075509:21081545:21081655:21086906:21086976 | 21081545:21081655 | ENSG00000109016.13 | ENST00000582161.1,ENST00000395511.3,ENST00000579303.1,ENST00000346603.4 |
| exon_skip_150065 | 17 | 21087046:21087123:21087683:21087776:21092023:21092168 | 21087683:21087776 | ENSG00000109016.13 | ENST00000395511.3,ENST00000578426.1,ENST00000579303.1,ENST00000346603.4 |
| exon_skip_150066 | 17 | 21087046:21087123:21087683:21087776:21094260:21094579 | 21087683:21087776 | ENSG00000109016.13 | ENST00000583388.1 |
| exon_skip_150070 | 17 | 21087697:21087776:21092023:21092176:21094260:21094579 | 21092023:21092176 | ENSG00000109016.13 | ENST00000395511.3,ENST00000578426.1,ENST00000579303.1,ENST00000346603.4 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for DHRS7B |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000395511 | 21075330 | 21075509 | Frame-shift |
| ENST00000395511 | 21081545 | 21081655 | Frame-shift |
| ENST00000395511 | 21087683 | 21087776 | In-frame |
| ENST00000395511 | 21092023 | 21092176 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000395511 | 21081545 | 21081655 | Frame-shift |
| ENST00000395511 | 21087683 | 21087776 | In-frame |
| ENST00000395511 | 21092023 | 21092176 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for DHRS7B |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000395511 | 2192 | 325 | 21087683 | 21087776 | 847 | 939 | 175 | 206 |
| ENST00000395511 | 2192 | 325 | 21092023 | 21092176 | 940 | 1092 | 206 | 257 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000395511 | 2192 | 325 | 21087683 | 21087776 | 847 | 939 | 175 | 206 |
| ENST00000395511 | 2192 | 325 | 21092023 | 21092176 | 940 | 1092 | 206 | 257 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q6IAN0 | 175 | 206 | 194 | 194 | Binding site | Note=Substrate;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| Q6IAN0 | 175 | 206 | 1 | 325 | Chain | ID=PRO_0000312105;Note=Dehydrogenase/reductase SDR family member 7B |
| Q6IAN0 | 175 | 206 | 39 | 325 | Topological domain | Note=Lumenal;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| Q6IAN0 | 206 | 257 | 207 | 207 | Active site | Note=Proton acceptor;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU10001 |
| Q6IAN0 | 206 | 257 | 1 | 325 | Chain | ID=PRO_0000312105;Note=Dehydrogenase/reductase SDR family member 7B |
| Q6IAN0 | 206 | 257 | 210 | 210 | Sequence conflict | Note=S->P;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| Q6IAN0 | 206 | 257 | 256 | 256 | Sequence conflict | Note=Y->C;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| Q6IAN0 | 206 | 257 | 39 | 325 | Topological domain | Note=Lumenal;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q6IAN0 | 175 | 206 | 194 | 194 | Binding site | Note=Substrate;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| Q6IAN0 | 175 | 206 | 1 | 325 | Chain | ID=PRO_0000312105;Note=Dehydrogenase/reductase SDR family member 7B |
| Q6IAN0 | 175 | 206 | 39 | 325 | Topological domain | Note=Lumenal;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| Q6IAN0 | 206 | 257 | 207 | 207 | Active site | Note=Proton acceptor;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU10001 |
| Q6IAN0 | 206 | 257 | 1 | 325 | Chain | ID=PRO_0000312105;Note=Dehydrogenase/reductase SDR family member 7B |
| Q6IAN0 | 206 | 257 | 210 | 210 | Sequence conflict | Note=S->P;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| Q6IAN0 | 206 | 257 | 256 | 256 | Sequence conflict | Note=Y->C;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| Q6IAN0 | 206 | 257 | 39 | 325 | Topological domain | Note=Lumenal;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
Top |
SNVs in the skipped exons for DHRS7B |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_150064 | 21081546 | 21081655 | 21081571 | 21081571 | Frame_Shift_Del | G | - | p.A75fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_150065 exon_skip_150066 | 21087684 | 21087776 | 21087763 | 21087763 | Frame_Shift_Del | T | - | p.P202fs |
| LUAD | TCGA-17-Z031-01 | exon_skip_150057 exon_skip_150058 | 21075331 | 21075509 | 21075495 | 21075495 | Nonsense_Mutation | C | G | p.S62* |
| UCEC | TCGA-AX-A0J0-01 | exon_skip_150064 | 21081546 | 21081655 | 21081629 | 21081629 | Nonsense_Mutation | G | T | p.E95* |
| UCS | TCGA-N5-A4RT-01 | exon_skip_150057 exon_skip_150058 | 21075331 | 21075509 | 21075510 | 21075510 | Splice_Site | G | T | . |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LOVO_LARGE_INTESTINE | 21081546 | 21081655 | 21081605 | 21081605 | Frame_Shift_Del | G | - | p.G87fs |
| GEO_LARGE_INTESTINE | 21075331 | 21075509 | 21075353 | 21075376 | In_Frame_Del | GCCATGGACTTCATCACCTCCACA | - | p.AMDFITST15del |
| REH_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 21075331 | 21075509 | 21075443 | 21075443 | Missense_Mutation | C | T | p.R45C |
| SNU1040_LARGE_INTESTINE | 21081546 | 21081655 | 21081570 | 21081570 | Missense_Mutation | C | T | p.A75V |
| HCT15_LARGE_INTESTINE | 21081546 | 21081655 | 21081638 | 21081638 | Missense_Mutation | G | A | p.A98T |
| NCIH1563_LUNG | 21081546 | 21081655 | 21081644 | 21081644 | Missense_Mutation | C | T | p.H100Y |
| MDAMB330_BREAST | 21087684 | 21087776 | 21087725 | 21087725 | Missense_Mutation | G | T | p.V190F |
| CW2_LARGE_INTESTINE | 21092024 | 21092176 | 21092026 | 21092026 | Missense_Mutation | G | A | p.A208T |
| CW2_LARGE_INTESTINE | 21092024 | 21092176 | 21092114 | 21092114 | Missense_Mutation | C | T | p.P237L |
| GT3TKB_STOMACH | 21081546 | 21081655 | 21081554 | 21081554 | Nonsense_Mutation | A | T | p.K70* |
| RERFLCAI_LUNG | 21081546 | 21081655 | 21081554 | 21081554 | Nonsense_Mutation | A | T | p.K70* |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for DHRS7B |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for DHRS7B |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for DHRS7B |
Top |
RelatedDrugs for DHRS7B |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for DHRS7B |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|