ExonSkipDB: functional annotation of exon skipping event in human

Gene summary for DOCK9

Gene summary

Gene information	Gene symbol	DOCK9
	Gene ID	23348
	Gene name	dedicator of cytokinesis 9
	Synonyms	ZIZ1\|ZIZIMIN1
	Cytomap	13q32.3
	Type of gene	protein-coding
	Description	dedicator of cytokinesis protein 9cdc42 guanine nucleotide exchange factor zizimin-1zizimin-1
	Modification date	20180522
	UniProtAcc	Q9BZ29
	Context	PubMed: DOCK9 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID)

Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Gene

GO ID

GO term

PubMed ID

Top

Exon skipping events across known transcript of Ensembl for DOCK9 from UCSC genome browser

Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure.
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Gene isoform structures and expression levels for DOCK9

Expression levels of gene isoforms across TCGA.

Expression levels of gene isoforms across GTEx.

Top

Exon skipping events with PSIs in TCGA for DOCK9

Information of exkip skipping event in TCGA.

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_104464	13	99446879:99447002:99448459:99448467:99449368:99449507	99448459:99448467	ENSG00000088387.13	ENST00000376460.1
exon_skip_104466	13	99449368:99449507:99449642:99449743:99452541:99452732	99449642:99449743	ENSG00000088387.13	ENST00000339416.2,ENST00000400228.2,ENST00000376460.1
exon_skip_104467	13	99452541:99452732:99457252:99457463:99459914:99460061	99457252:99457463	ENSG00000088387.13	ENST00000419908.1,ENST00000339416.2,ENST00000400228.2,ENST00000376460.1
exon_skip_104468	13	99459914:99460061:99460893:99460929:99461605:99461719	99460893:99460929	ENSG00000088387.13	ENST00000400228.2
exon_skip_104469	13	99460893:99460929:99461376:99461382:99461605:99461719	99461376:99461382	ENSG00000088387.13	ENST00000376460.1
exon_skip_104471	13	99476651:99476758:99478125:99478194:99479083:99479141	99478125:99478194	ENSG00000088387.13	ENST00000419908.1,ENST00000448493.2,ENST00000339416.2,ENST00000376460.1
exon_skip_104473	13	99476651:99476758:99478125:99478229:99479083:99479141	99478125:99478229	ENSG00000088387.13	ENST00000481051.1
exon_skip_104475	13	99479083:99479141:99481560:99481776:99481896:99482010	99481560:99481776	ENSG00000088387.13	ENST00000448493.2,ENST00000339416.2,ENST00000340449.3,ENST00000400228.2,ENST00000376460.1
exon_skip_104477	13	99483649:99483784:99483902:99484040:99489747:99489863	99483902:99484040	ENSG00000088387.13	ENST00000449796.1,ENST00000448493.2,ENST00000339416.2,ENST00000340449.3,ENST00000376460.1
exon_skip_104479	13	99489747:99489863:99497582:99497626:99500845:99500893	99497582:99497626	ENSG00000088387.13	ENST00000449796.1
exon_skip_104481	13	99489747:99489863:99498177:99498245:99500845:99500893	99498177:99498245	ENSG00000088387.13	ENST00000339416.2,ENST00000376460.1
exon_skip_104482	13	99489747:99489863:99498177:99498314:99500845:99500893	99498177:99498314	ENSG00000088387.13	ENST00000450257.1
exon_skip_104491	13	99498177:99498245:99498773:99498810:99500845:99500893	99498773:99498810	ENSG00000088387.13	ENST00000448493.2
exon_skip_104492	13	99498201:99498314:99498773:99498810:99500845:99500893	99498773:99498810	ENSG00000088387.13	ENST00000472874.1
exon_skip_104494	13	99500845:99500893:99502300:99502367:99505661:99505776	99502300:99502367	ENSG00000088387.13	ENST00000449796.1,ENST00000448493.2,ENST00000339416.2,ENST00000472874.1,ENST00000376460.1
exon_skip_104496	13	99508151:99508285:99512658:99512776:99515272:99515386	99512658:99512776	ENSG00000088387.13	ENST00000448493.2,ENST00000339416.2,ENST00000376460.1
exon_skip_104498	13	99520484:99520631:99532151:99532223:99532800:99532926	99532151:99532223	ENSG00000088387.13	ENST00000442173.1,ENST00000448493.2,ENST00000339416.2,ENST00000376460.1
exon_skip_104500	13	99540885:99540965:99549741:99549864:99550432:99550515	99549741:99549864	ENSG00000088387.13	ENST00000442173.1,ENST00000448493.2,ENST00000339416.2,ENST00000376460.1
exon_skip_104501	13	99573207:99573342:99574304:99574400:99575555:99575625	99574304:99574400	ENSG00000088387.13	ENST00000442173.1,ENST00000448493.2,ENST00000339416.2,ENST00000376460.1
exon_skip_104503	13	99575555:99575625:99578090:99578173:99582421:99582511	99578090:99578173	ENSG00000088387.13	ENST00000442173.1,ENST00000448493.2,ENST00000339416.2,ENST00000376460.1,ENST00000427887.1
exon_skip_104504	13	99582421:99582511:99607688:99607805:99738476:99738647	99607688:99607805	ENSG00000088387.13	ENST00000339416.2,ENST00000427887.1
exon_skip_104505	13	99607688:99607805:99611656:99611788:99738476:99738647	99611656:99611788	ENSG00000088387.13	ENST00000479769.1

PSI values of skipped exons in TCGA.

Top

Exon skipping events with PSIs in GTEx for DOCK9

Information of exkip skipping event in GTEx

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_104464	13	99446879:99447002:99448459:99448467:99449368:99449507	99448459:99448467	ENSG00000088387.13	ENST00000376460.1
exon_skip_104466	13	99449368:99449507:99449642:99449743:99452541:99452732	99449642:99449743	ENSG00000088387.13	ENST00000400228.2,ENST00000376460.1,ENST00000339416.2
exon_skip_104467	13	99452541:99452732:99457252:99457463:99459914:99460061	99457252:99457463	ENSG00000088387.13	ENST00000400228.2,ENST00000376460.1,ENST00000339416.2,ENST00000419908.1
exon_skip_104468	13	99459914:99460061:99460893:99460929:99461605:99461719	99460893:99460929	ENSG00000088387.13	ENST00000400228.2
exon_skip_104469	13	99460893:99460929:99461376:99461382:99461605:99461719	99461376:99461382	ENSG00000088387.13	ENST00000376460.1
exon_skip_104471	13	99476651:99476758:99478125:99478194:99479083:99479141	99478125:99478194	ENSG00000088387.13	ENST00000376460.1,ENST00000339416.2,ENST00000419908.1,ENST00000448493.2
exon_skip_104473	13	99476651:99476758:99478125:99478229:99479083:99479141	99478125:99478229	ENSG00000088387.13	ENST00000481051.1
exon_skip_104475	13	99479083:99479141:99481560:99481776:99481896:99482010	99481560:99481776	ENSG00000088387.13	ENST00000400228.2,ENST00000376460.1,ENST00000339416.2,ENST00000340449.3,ENST00000448493.2
exon_skip_104477	13	99483649:99483784:99483902:99484040:99489747:99489863	99483902:99484040	ENSG00000088387.13	ENST00000376460.1,ENST00000339416.2,ENST00000340449.3,ENST00000448493.2,ENST00000449796.1
exon_skip_104479	13	99489747:99489863:99497582:99497626:99500845:99500893	99497582:99497626	ENSG00000088387.13	ENST00000449796.1
exon_skip_104481	13	99489747:99489863:99498177:99498245:99500845:99500893	99498177:99498245	ENSG00000088387.13	ENST00000376460.1,ENST00000339416.2
exon_skip_104482	13	99489747:99489863:99498177:99498314:99500845:99500893	99498177:99498314	ENSG00000088387.13	ENST00000450257.1
exon_skip_104491	13	99498177:99498245:99498773:99498810:99500845:99500893	99498773:99498810	ENSG00000088387.13	ENST00000448493.2
exon_skip_104492	13	99498201:99498314:99498773:99498810:99500845:99500893	99498773:99498810	ENSG00000088387.13	ENST00000472874.1
exon_skip_104494	13	99500845:99500893:99502300:99502367:99505661:99505776	99502300:99502367	ENSG00000088387.13	ENST00000376460.1,ENST00000339416.2,ENST00000448493.2,ENST00000449796.1,ENST00000472874.1
exon_skip_104496	13	99508151:99508285:99512658:99512776:99515272:99515386	99512658:99512776	ENSG00000088387.13	ENST00000376460.1,ENST00000339416.2,ENST00000448493.2
exon_skip_104498	13	99520484:99520631:99532151:99532223:99532800:99532926	99532151:99532223	ENSG00000088387.13	ENST00000376460.1,ENST00000339416.2,ENST00000448493.2,ENST00000442173.1
exon_skip_104500	13	99540885:99540965:99549741:99549864:99550432:99550515	99549741:99549864	ENSG00000088387.13	ENST00000376460.1,ENST00000339416.2,ENST00000448493.2,ENST00000442173.1
exon_skip_104501	13	99573207:99573342:99574304:99574400:99575555:99575625	99574304:99574400	ENSG00000088387.13	ENST00000376460.1,ENST00000339416.2,ENST00000448493.2,ENST00000442173.1
exon_skip_104503	13	99575555:99575625:99578090:99578173:99582421:99582511	99578090:99578173	ENSG00000088387.13	ENST00000376460.1,ENST00000339416.2,ENST00000448493.2,ENST00000442173.1,ENST00000427887.1
exon_skip_104505	13	99607688:99607805:99611656:99611788:99738476:99738647	99611656:99611788	ENSG00000088387.13	ENST00000479769.1

PSI values of skipped exons in GTEx.

* Skipped exon sequences.

Top

Open reading frame (ORF) annotation in the exon skipping event for DOCK9

Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms.

ENST

Start of skipped exon

End of skipped exon

ORF

Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms.

ENST

Start of skipped exon

End of skipped exon

ORF

Top

Infer the effects of exon skipping event on protein functional features for DOCK9

Exon skipping at the protein sequence level and followed lost functional features.
* Click on the image to enlarge it in a new window.

Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases.

ENST

Length of mRNA

Length of AA seq.

Genomic start

Genomic end

mRNA start

mRNA end

AA start

AA end

Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases.

ENST

Length of mRNA

Length of AA seq.

Genomic start

Genomic end

mRNA start

mRNA end

AA start

AA end

Lost protein functional features of individual exon skipping events in TCGA.

UniProt acc.

Start of exon skipping (AA)

End of exon skipping (AA)

Protein feature start (AA)

Protein feature end (AA)

Category of protein feature

Description of feature

Lost protein functional features of individual exon skipping events in GTEx.

UniProt acc.

Start of exon skipping (AA)

End of exon skipping (AA)

Protein feature start (AA)

Protein feature end (AA)

Category of protein feature

Description of feature

Top

SNVs in the skipped exons for DOCK9

- Lollipop plot for presenting exon skipping associated SNVs.
* Click on the image to enlarge it in a new window.

- Differential PSIs between mutated versus non-mutated samples.

- Non-synonymous mutations located in the skipped exons in TCGA.

Cancer type	Sample	ESID	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
LIHC	TCGA-DD-A39Y-01	exon_skip_104467	99457253	99457463	99457272	99457272	Frame_Shift_Del	T	-	p.K1916fs
LIHC	TCGA-DD-A1EG-01	exon_skip_104467	99457253	99457463	99457289	99457289	Frame_Shift_Del	C	-	p.V1911fs
LIHC	TCGA-DD-A3A0-01	exon_skip_104467	99457253	99457463	99457397	99457397	Frame_Shift_Del	C	-	p.D1875fs
PRAD	TCGA-HC-7078-01	exon_skip_104467	99457253	99457463	99457438	99457438	Frame_Shift_Del	T	-	p.K1861fs
UCEC	TCGA-B5-A0JZ-01	exon_skip_104475	99481561	99481776	99481577	99481577	Frame_Shift_Del	T	-	p.N1628fs
LIHC	TCGA-DD-A1EG-01	exon_skip_104477	99483903	99484040	99483963	99483963	Frame_Shift_Del	T	-	p.K1441fs
LIHC	TCGA-G3-A3CJ-01	exon_skip_104477	99483903	99484040	99483963	99483963	Frame_Shift_Del	T	-	p.K1441fs
LIHC	TCGA-DD-A1EG-01	exon_skip_104477	99483903	99484040	99483990	99483990	Frame_Shift_Del	A	-	p.F1432fs
LIHC	TCGA-DD-A39Y-01	exon_skip_104477	99483903	99484040	99483990	99483990	Frame_Shift_Del	A	-	p.F1432fs
BLCA	TCGA-DK-A6B6-01	exon_skip_104494	99502301	99502367	99502312	99502312	Frame_Shift_Del	A	-	p.F1334fs
ESCA	TCGA-L5-A4OI-01	exon_skip_104494	99502301	99502367	99502312	99502312	Frame_Shift_Del	A	-	p.F1334fs
ESCA	TCGA-L5-A4OI-01	exon_skip_104494	99502301	99502367	99502312	99502312	Frame_Shift_Del	A	-	p.F1335fs
STAD	TCGA-BR-4292-01	exon_skip_104494	99502301	99502367	99502312	99502312	Frame_Shift_Del	A	-	p.F1335fs
LIHC	TCGA-DD-A39Y-01	exon_skip_104500	99549742	99549864	99549826	99549826	Frame_Shift_Del	T	-	p.N542fs
LIHC	TCGA-G3-A3CJ-01	exon_skip_104500	99549742	99549864	99549826	99549826	Frame_Shift_Del	T	-	p.N542fs
LUAD	TCGA-55-A4DG-01	exon_skip_104500	99549742	99549864	99549853	99549853	Frame_Shift_Del	T	-	p.K533fs
STAD	TCGA-BR-6802-01	exon_skip_104466	99449643	99449743	99449686	99449686	Nonsense_Mutation	G	A	p.R2007*
LUAD	TCGA-73-4666-01	exon_skip_104475	99481561	99481776	99481647	99481647	Nonsense_Mutation	T	A	p.K1604*
BLCA	TCGA-FJ-A3ZE-01	exon_skip_104498	99532152	99532223	99532221	99532221	Nonsense_Mutation	G	T	p.Y958*
BLCA	TCGA-FJ-A3ZE-01	exon_skip_104498	99532152	99532223	99532221	99532221	Nonsense_Mutation	G	T	p.Y959*
UCEC	TCGA-B5-A11N-01	exon_skip_104503	99578091	99578173	99578104	99578104	Nonsense_Mutation	G	A	p.R136*
HNSC	TCGA-CR-7365-01	exon_skip_104481	99498178	99498245	99498246	99498246	Splice_Site	C	G	p.R1355_splice

- Depth of coverage in the three exons composing exon skipping event

Depth of coverage in three exons

Mutation description

- Non-synonymous mutations located in the skipped exons in CCLE.

Sample	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
JHUEM7_ENDOMETRIUM	99502301	99502367	99502311	99502312	Frame_Shift_Ins	-	A	p.T1335fs
P31FUJ_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	99502301	99502367	99502311	99502312	Frame_Shift_Ins	-	A	p.T1335fs
MM426_SKIN	99449643	99449743	99449667	99449667	Missense_Mutation	A	G	p.V2012A
PCI6A_UPPER_AERODIGESTIVE_TRACT	99449643	99449743	99449673	99449673	Missense_Mutation	T	C	p.N2010S
P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	99449643	99449743	99449691	99449691	Missense_Mutation	G	T	p.T2004K
SNU1077_ENDOMETRIUM	99457253	99457463	99457259	99457259	Missense_Mutation	G	T	p.L1921M
KM12_LARGE_INTESTINE	99457253	99457463	99457271	99457271	Missense_Mutation	G	A	p.R1917W
EFO27_OVARY	99457253	99457463	99457295	99457295	Missense_Mutation	C	T	p.G1909S
CCK81_LARGE_INTESTINE	99457253	99457463	99457343	99457343	Missense_Mutation	G	A	p.R1893C
MM386_SKIN	99457253	99457463	99457394	99457394	Missense_Mutation	C	T	p.E1876K
RL952_ENDOMETRIUM	99478126	99478229	99478150	99478150	Missense_Mutation	C	T	p.A1667T
RL952_ENDOMETRIUM	99478126	99478194	99478150	99478150	Missense_Mutation	C	T	p.A1667T
SNU175_LARGE_INTESTINE	99481561	99481776	99481727	99481727	Missense_Mutation	G	A	p.T1577M
AN3CA_ENDOMETRIUM	99481561	99481776	99481731	99481731	Missense_Mutation	G	A	p.R1576C
MCC26_SKIN	99481561	99481776	99481736	99481736	Missense_Mutation	C	T	p.R1574K
RPMI7951_SKIN	99481561	99481776	99481736	99481736	Missense_Mutation	C	T	p.R1574K
SNU324_PANCREAS	99483903	99484040	99484004	99484004	Missense_Mutation	T	C	p.M1428V
BICR18_UPPER_AERODIGESTIVE_TRACT	99498178	99498314	99498193	99498193	Missense_Mutation	G	C	p.L1372V
BICR18_UPPER_AERODIGESTIVE_TRACT	99498178	99498245	99498193	99498193	Missense_Mutation	G	C	p.L1372V
DAUDI_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	99498178	99498314	99498193	99498193	Missense_Mutation	G	C	p.L1372V
DAUDI_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	99498178	99498245	99498193	99498193	Missense_Mutation	G	C	p.L1372V
KARPAS422_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	99498774	99498810	99498797	99498797	Missense_Mutation	C	T	p.V1371M
HEC251_ENDOMETRIUM	99502301	99502367	99502325	99502325	Missense_Mutation	A	C	p.L1330R
A3KAW_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	99512659	99512776	99512773	99512773	Missense_Mutation	C	T	p.V1195M
HEC251_ENDOMETRIUM	99574305	99574400	99574337	99574337	Missense_Mutation	T	C	p.N184D
SW756_CERVIX	99578091	99578173	99578094	99578094	Missense_Mutation	G	A	p.P138L
BICR18_UPPER_AERODIGESTIVE_TRACT	99578091	99578173	99578136	99578136	Missense_Mutation	T	G	p.N124T
SNU1197_LARGE_INTESTINE	99607689	99607805	99607760	99607760	Missense_Mutation	C	T	p.V58I
HEC59_ENDOMETRIUM	99457253	99457463	99457313	99457313	Nonsense_Mutation	G	A	p.Q1903*
PCM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	99483903	99484040	99483959	99483959	Nonsense_Mutation	G	A	p.Q1443*
COLO684_ENDOMETRIUM	99449643	99449743	99449507	99449641	Splice_Site	CCTGGAATGGTACAGGCGGGAGAAACAAAGGCACGCAGAGGATAAGGCATGAGTCCAACCAGCAGCATCTCCTTCCCGAATGAGTACAGAAATGATCAATACTCGAAGAGAAAAAGATGCTTTCAGTGTGCTTTA	-	p.S2020del
SNU1_STOMACH	99461377	99461382	99461378	99461378	Splice_Site	G	A	p.A1791V
HEC108_ENDOMETRIUM	99478126	99478229	99478127	99478128	Splice_Site	-	C	p.G1674fs
HEC108_ENDOMETRIUM	99478126	99478194	99478127	99478128	Splice_Site	-	C	p.G1674fs

Top

Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for DOCK9

sQTL information located at the skipped exons.

Exon skip ID

Chromosome

Three exons

Skippped exon

ENST

Cancer type

SNP id

Location

DNA change (ref/var)

P-value

Top

Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for DOCK9

Top

Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for DOCK9

Top

RelatedDrugs for DOCK9

Approved drugs targeting this gene.
(DrugBank Version 5.1.0 2018-04-02)

Gene

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

RelatedDiseases for DOCK9

Diseases associated with this gene.
(DisGeNet 4.0)

Gene	Disease ID	Disease name	# pubmeds	Source
DOCK9	C0005586	Bipolar Disorder	1	PSYGENET

	Gene summary
	Gene structures and expression levels
	Exon skipping events with PSIs in TCGA
	Exon skipping events with PSIs in GTEx
	Open reading frame (ORF) annotation in the exon skipping event
	Exon skipping events in the canonical protein sequence
	SNVs in the skipped exons with depth of coverage
	Splicing Quantitative Trait Loci (sQTLs) in the skipped exons
	Splicing Quantitative Trait Methylation (sQTM) in the skipped exon
	Related drugs with this gene
	Related diseases with this gene

Home

Download

Statistics

Landscape

Help

Contact

Gene summary for DOCK9

Exon skipping events across known transcript of Ensembl for DOCK9 from UCSC genome browser

Gene isoform structures and expression levels for DOCK9

Exon skipping events with PSIs in TCGA for DOCK9

Exon skipping events with PSIs in GTEx for DOCK9

Open reading frame (ORF) annotation in the exon skipping event for DOCK9

Infer the effects of exon skipping event on protein functional features for DOCK9

SNVs in the skipped exons for DOCK9

Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for DOCK9

Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for DOCK9

Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for DOCK9

RelatedDrugs for DOCK9

RelatedDiseases for DOCK9