ExonSkipDB: functional annotation of exon skipping event in human

Gene summary for EPN2

Gene summary

Gene information	Gene symbol	EPN2
	Gene ID	22905
	Gene name	epsin 2
	Synonyms	EHB21
	Cytomap	17p11.2
	Type of gene	protein-coding
	Description	epsin-2EPS-15-interacting protein 2Eps15 binding protein
	Modification date	20180522
	UniProtAcc	O95208
	Context	PubMed: EPN2 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID)

Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Gene

GO ID

GO term

PubMed ID

Top

Exon skipping events across known transcript of Ensembl for EPN2 from UCSC genome browser

Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure.
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Gene isoform structures and expression levels for EPN2

Expression levels of gene isoforms across TCGA.

Expression levels of gene isoforms across GTEx.

Top

Exon skipping events with PSIs in TCGA for EPN2

Information of exkip skipping event in TCGA.

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_149778	17	19140809:19140844:19152683:19152839:19185267:19185390	19152683:19152839	ENSG00000072134.11	ENST00000582234.1
exon_skip_149785	17	19140809:19140844:19179709:19179851:19185267:19185390	19179709:19179851	ENSG00000072134.11	ENST00000583197.1
exon_skip_149787	17	19140809:19140844:19183174:19183293:19185267:19185390	19183174:19183293	ENSG00000072134.11	ENST00000581024.1
exon_skip_149789	17	19140809:19140844:19185267:19185390:19186262:19186318	19185267:19185390	ENSG00000072134.11	ENST00000582969.1,ENST00000347697.2,ENST00000395628.2,ENST00000314728.5
exon_skip_149811	17	19185291:19185390:19186262:19187027:19213197:19213310	19186262:19187027	ENSG00000072134.11	ENST00000347697.2,ENST00000495155.1,ENST00000395628.2
exon_skip_149812	17	19186359:19187027:19188932:19189103:19213197:19213310	19188932:19189103	ENSG00000072134.11	ENST00000395626.1,ENST00000314728.5
exon_skip_149815	17	19215364:19215457:19216417:19216592:19232023:19232075	19216417:19216592	ENSG00000072134.11	ENST00000395626.1,ENST00000580579.1,ENST00000347697.2,ENST00000395620.2,ENST00000395618.3,ENST00000395628.2,ENST00000314728.5
exon_skip_149819	17	19215364:19215457:19216435:19216592:19232023:19232075	19216435:19216592	ENSG00000072134.11	ENST00000494192.2
exon_skip_149822	17	19215364:19215457:19216438:19216592:19232023:19232075	19216438:19216592	ENSG00000072134.11	ENST00000572627.2,ENST00000571254.1,ENST00000575595.1
exon_skip_149826	17	19232023:19232200:19232873:19232960:19235165:19235286	19232873:19232960	ENSG00000072134.11	ENST00000585097.1,ENST00000347697.2,ENST00000571254.1,ENST00000395620.2,ENST00000395618.3,ENST00000575595.1,ENST00000494192.2,ENST00000314728.5
exon_skip_149829	17	19232873:19232960:19235165:19235381:19237268:19237643	19235165:19235381	ENSG00000072134.11	ENST00000347697.2,ENST00000571254.1,ENST00000395620.2,ENST00000395618.3,ENST00000575595.1,ENST00000314728.5

PSI values of skipped exons in TCGA.

Top

Exon skipping events with PSIs in GTEx for EPN2

Information of exkip skipping event in GTEx

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_149778	17	19140809:19140844:19152683:19152839:19185267:19185390	19152683:19152839	ENSG00000072134.11	ENST00000582234.1
exon_skip_149785	17	19140809:19140844:19179709:19179851:19185267:19185390	19179709:19179851	ENSG00000072134.11	ENST00000583197.1
exon_skip_149787	17	19140809:19140844:19183174:19183293:19185267:19185390	19183174:19183293	ENSG00000072134.11	ENST00000581024.1
exon_skip_149789	17	19140809:19140844:19185267:19185390:19186262:19186318	19185267:19185390	ENSG00000072134.11	ENST00000314728.5,ENST00000347697.2,ENST00000395628.2,ENST00000582969.1
exon_skip_149807	17	19174861:19175051:19176446:19176588:19177363:19177631	19176446:19176588	ENSG00000072134.11	ENST00000441293.2
exon_skip_149811	17	19185291:19185390:19186262:19187027:19213197:19213310	19186262:19187027	ENSG00000072134.11	ENST00000347697.2,ENST00000395628.2,ENST00000495155.1
exon_skip_149812	17	19186359:19187027:19188932:19189103:19213197:19213310	19188932:19189103	ENSG00000072134.11	ENST00000314728.5,ENST00000395626.1
exon_skip_149815	17	19215364:19215457:19216417:19216592:19232023:19232075	19216417:19216592	ENSG00000072134.11	ENST00000314728.5,ENST00000347697.2,ENST00000580579.1,ENST00000395618.3,ENST00000395628.2,ENST00000395620.2,ENST00000395626.1
exon_skip_149819	17	19215364:19215457:19216435:19216592:19232023:19232075	19216435:19216592	ENSG00000072134.11	ENST00000494192.2
exon_skip_149822	17	19215364:19215457:19216438:19216592:19232023:19232075	19216438:19216592	ENSG00000072134.11	ENST00000575595.1,ENST00000571254.1,ENST00000572627.2
exon_skip_149826	17	19232023:19232200:19232873:19232960:19235165:19235286	19232873:19232960	ENSG00000072134.11	ENST00000314728.5,ENST00000347697.2,ENST00000395618.3,ENST00000494192.2,ENST00000575595.1,ENST00000395620.2,ENST00000571254.1,ENST00000585097.1
exon_skip_149829	17	19232873:19232960:19235165:19235381:19237268:19237643	19235165:19235381	ENSG00000072134.11	ENST00000314728.5,ENST00000347697.2,ENST00000395618.3,ENST00000575595.1,ENST00000395620.2,ENST00000571254.1

PSI values of skipped exons in GTEx.

* Skipped exon sequences.

Top

Open reading frame (ORF) annotation in the exon skipping event for EPN2

Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms.

ENST	Start of skipped exon	End of skipped exon	ORF
ENST00000314728	19185267	19185390	5UTR-5UTR
ENST00000314728	19216417	19216592	Frame-shift
ENST00000314728	19188932	19189103	In-frame
ENST00000314728	19232873	19232960	In-frame
ENST00000314728	19235165	19235381	In-frame

Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms.

ENST	Start of skipped exon	End of skipped exon	ORF
ENST00000314728	19185267	19185390	5UTR-5UTR
ENST00000314728	19216417	19216592	Frame-shift
ENST00000314728	19188932	19189103	In-frame
ENST00000314728	19232873	19232960	In-frame
ENST00000314728	19235165	19235381	In-frame

Top

Infer the effects of exon skipping event on protein functional features for EPN2

Exon skipping at the protein sequence level and followed lost functional features.
* Click on the image to enlarge it in a new window.

Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases.

ENST	Length of mRNA	Length of AA seq.	Genomic start	Genomic end	mRNA start	mRNA end	AA start	AA end
ENST00000314728	4888	641	19188932	19189103	1080	1250	198	255
ENST00000314728	4888	641	19232873	19232960	1809	1895	441	470
ENST00000314728	4888	641	19235165	19235381	1896	2111	470	542

Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases.

ENST	Length of mRNA	Length of AA seq.	Genomic start	Genomic end	mRNA start	mRNA end	AA start	AA end
ENST00000314728	4888	641	19188932	19189103	1080	1250	198	255
ENST00000314728	4888	641	19232873	19232960	1809	1895	441	470
ENST00000314728	4888	641	19235165	19235381	1896	2111	470	542

Lost protein functional features of individual exon skipping events in TCGA.

UniProt acc.	Start of exon skipping (AA)	End of exon skipping (AA)	Protein feature start (AA)	Protein feature end (AA)	Category of protein feature	Description of feature
O95208	198	255	1	285	Alternative sequence	ID=VSP_047003;Note=In isoform 4. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:14702039;Dbxref=PMID:14702039
O95208	198	255	200	256	Alternative sequence	ID=VSP_009155;Note=In isoform 2 and isoform 3. Missing;Ontology_term=ECO:0000303,ECO:0000303;evidence=ECO:0000303\|PubMed:10567358,ECO:0000303\|PubMed:14702039;Dbxref=PMID:10567358,PMID:14702039
O95208	198	255	1	641	Chain	ID=PRO_0000074516;Note=Epsin-2
O95208	441	470	1	641	Chain	ID=PRO_0000074516;Note=Epsin-2
O95208	441	470	352	639	Region	Note=6 X 3 AA repeats of [DE]-P-W
O95208	470	542	1	641	Chain	ID=PRO_0000074516;Note=Epsin-2
O95208	470	542	486	486	Modified residue	Note=Phosphoserine;Ontology_term=ECO:0000250;evidence=ECO:0000250\|UniProtKB:Q9Z1Z3
O95208	470	542	508	508	Modified residue	Note=Phosphothreonine;Ontology_term=ECO:0000250;evidence=ECO:0000250\|UniProtKB:Q9Z1Z3
O95208	470	542	531	531	Natural variant	ID=VAR_047923;Note=P->T;Dbxref=dbSNP:rs1062727
O95208	470	542	532	532	Natural variant	ID=VAR_053081;Note=P->T;Dbxref=dbSNP:rs1062727
O95208	470	542	352	639	Region	Note=6 X 3 AA repeats of [DE]-P-W
O95208	470	542	537	639	Region	Note=3 X 3 AA repeats of N-P-F
O95208	470	542	537	539	Repeat	Note=1

Lost protein functional features of individual exon skipping events in GTEx.

UniProt acc.	Start of exon skipping (AA)	End of exon skipping (AA)	Protein feature start (AA)	Protein feature end (AA)	Category of protein feature	Description of feature
O95208	198	255	1	285	Alternative sequence	ID=VSP_047003;Note=In isoform 4. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:14702039;Dbxref=PMID:14702039
O95208	198	255	200	256	Alternative sequence	ID=VSP_009155;Note=In isoform 2 and isoform 3. Missing;Ontology_term=ECO:0000303,ECO:0000303;evidence=ECO:0000303\|PubMed:10567358,ECO:0000303\|PubMed:14702039;Dbxref=PMID:10567358,PMID:14702039
O95208	198	255	1	641	Chain	ID=PRO_0000074516;Note=Epsin-2
O95208	441	470	1	641	Chain	ID=PRO_0000074516;Note=Epsin-2
O95208	441	470	352	639	Region	Note=6 X 3 AA repeats of [DE]-P-W
O95208	470	542	1	641	Chain	ID=PRO_0000074516;Note=Epsin-2
O95208	470	542	486	486	Modified residue	Note=Phosphoserine;Ontology_term=ECO:0000250;evidence=ECO:0000250\|UniProtKB:Q9Z1Z3
O95208	470	542	508	508	Modified residue	Note=Phosphothreonine;Ontology_term=ECO:0000250;evidence=ECO:0000250\|UniProtKB:Q9Z1Z3
O95208	470	542	531	531	Natural variant	ID=VAR_047923;Note=P->T;Dbxref=dbSNP:rs1062727
O95208	470	542	532	532	Natural variant	ID=VAR_053081;Note=P->T;Dbxref=dbSNP:rs1062727
O95208	470	542	352	639	Region	Note=6 X 3 AA repeats of [DE]-P-W
O95208	470	542	537	639	Region	Note=3 X 3 AA repeats of N-P-F
O95208	470	542	537	539	Repeat	Note=1

Top

SNVs in the skipped exons for EPN2

- Lollipop plot for presenting exon skipping associated SNVs.
* Click on the image to enlarge it in a new window.

- Differential PSIs between mutated versus non-mutated samples.

- Non-synonymous mutations located in the skipped exons in TCGA.

Cancer type	Sample	ESID	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
LIHC	TCGA-DD-A1EG-01	exon_skip_149811	19186263	19187027	19186512	19186512	Frame_Shift_Del	C	-	p.A27fs
LIHC	TCGA-G3-A3CJ-01	exon_skip_149811	19186263	19187027	19186525	19186525	Frame_Shift_Del	C	-	p.D31fs
STAD	TCGA-BR-4362-01	exon_skip_149822 exon_skip_149815 exon_skip_149819	19216418	19216592	19216468	19216468	Frame_Shift_Del	C	-	p.L341fs
STAD	TCGA-BR-4362-01	exon_skip_149822 exon_skip_149815 exon_skip_149819	19216436	19216592	19216468	19216468	Frame_Shift_Del	C	-	p.L341fs
STAD	TCGA-BR-4362-01	exon_skip_149822 exon_skip_149815 exon_skip_149819	19216439	19216592	19216468	19216468	Frame_Shift_Del	C	-	p.L341fs
LUAD	TCGA-49-6742-01	exon_skip_149822 exon_skip_149815 exon_skip_149819	19216418	19216592	19216480	19216480	Frame_Shift_Del	C	-	p.G345fs
LUAD	TCGA-49-6742-01	exon_skip_149822 exon_skip_149815 exon_skip_149819	19216436	19216592	19216480	19216480	Frame_Shift_Del	C	-	p.G345fs
LUAD	TCGA-49-6742-01	exon_skip_149822 exon_skip_149815 exon_skip_149819	19216439	19216592	19216480	19216480	Frame_Shift_Del	C	-	p.G345fs
LIHC	TCGA-G3-A3CJ-01	exon_skip_149822 exon_skip_149815 exon_skip_149819	19216418	19216592	19216542	19216542	Frame_Shift_Del	G	-	p.W366fs
LIHC	TCGA-G3-A3CJ-01	exon_skip_149822 exon_skip_149815 exon_skip_149819	19216436	19216592	19216542	19216542	Frame_Shift_Del	G	-	p.W366fs
LIHC	TCGA-G3-A3CJ-01	exon_skip_149822 exon_skip_149815 exon_skip_149819	19216439	19216592	19216542	19216542	Frame_Shift_Del	G	-	p.W366fs
LIHC	TCGA-DD-A3A0-01	exon_skip_149826	19232874	19232960	19232950	19232950	Frame_Shift_Del	A	-	p.S467fs
STAD	TCGA-BR-4280-01	exon_skip_149826	19232874	19232960	19232950	19232950	Frame_Shift_Del	A	-	p.S467X
STAD	TCGA-HU-A4GT-01	exon_skip_149826	19232874	19232960	19232950	19232950	Frame_Shift_Del	A	-	p.S467X
STAD	TCGA-HU-A4GX-01	exon_skip_149826	19232874	19232960	19232950	19232950	Frame_Shift_Del	A	-	p.S467X
UCEC	TCGA-D1-A176-01	exon_skip_149826	19232874	19232960	19232950	19232950	Frame_Shift_Del	A	-	p.S467fs
UCEC	TCGA-D1-A177-01	exon_skip_149826	19232874	19232960	19232950	19232950	Frame_Shift_Del	A	-	p.S467fs
BRCA	TCGA-A2-A0T0-01	exon_skip_149829	19235166	19235381	19235190	19235211	Frame_Shift_Del	CCCAAAACAATGGAACTACCAG	-	p.Q480fs
LIHC	TCGA-DD-A3A0-01	exon_skip_149829	19235166	19235381	19235234	19235234	Frame_Shift_Del	C	-	p.P494fs
COAD	TCGA-G4-6586-01	exon_skip_149826	19232874	19232960	19232949	19232950	Frame_Shift_Ins	-	A	p.S467fs
HNSC	TCGA-CR-6467-01	exon_skip_149826	19232874	19232960	19232949	19232950	Frame_Shift_Ins	-	A	p.*467fs
HNSC	TCGA-CR-6467-01	exon_skip_149826	19232874	19232960	19232949	19232950	Frame_Shift_Ins	-	A	p.S467fs
HNSC	TCGA-F7-A624-01	exon_skip_149826	19232874	19232960	19232949	19232950	Frame_Shift_Ins	-	A	p.*467fs
LGG	TCGA-HT-8564-01	exon_skip_149826	19232874	19232960	19232949	19232950	Frame_Shift_Ins	-	A	p.S467fs
STAD	TCGA-BR-6452-01	exon_skip_149826	19232874	19232960	19232949	19232950	Frame_Shift_Ins	-	A	p.S467fs
UCEC	TCGA-A5-A0G5-01	exon_skip_149826	19232874	19232960	19232949	19232950	Frame_Shift_Ins	-	A	p.S467fs
STAD	TCGA-BR-6452-01	exon_skip_149826	19232874	19232960	19232950	19232951	Frame_Shift_Ins	-	A	p.S467fs
STAD	TCGA-CG-5728-01	exon_skip_149826	19232874	19232960	19232950	19232951	Frame_Shift_Ins	-	A	p.S467fs

- Depth of coverage in the three exons composing exon skipping event

Depth of coverage in three exons

Mutation description

- Non-synonymous mutations located in the skipped exons in CCLE.

Sample	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
MINO_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	19186263	19187027	19187006	19187006	Frame_Shift_Del	T	-	p.S192fs
MINO_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	19186263	19187027	19187003	19187004	Frame_Shift_Ins	-	A	p.G191fs
CW2_LARGE_INTESTINE	19232874	19232960	19232949	19232950	Frame_Shift_Ins	-	A	p.SK467fs
MOLT16_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	19232874	19232960	19232949	19232950	Frame_Shift_Ins	-	A	p.SK467fs
SISO_CERVIX	19235166	19235381	19235342	19235343	Frame_Shift_Ins	-	C	p.A530fs
GRST_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	19235166	19235381	19235342	19235343	Frame_Shift_Ins	-	C	p.A530fs
HEC6_ENDOMETRIUM	19186263	19187027	19186437	19186437	Missense_Mutation	C	T	p.T2M
HT144_SKIN	19186263	19187027	19186443	19186443	Missense_Mutation	C	T	p.S4L
NCIH1155_LUNG	19186263	19187027	19186472	19186472	Missense_Mutation	G	A	p.V14M
KU1919_URINARY_TRACT	19186263	19187027	19186545	19186545	Missense_Mutation	C	T	p.S38F
COLO792_SKIN	19186263	19187027	19186593	19186593	Missense_Mutation	C	T	p.S54L
NCIH1155_LUNG	19186263	19187027	19186700	19186700	Missense_Mutation	G	A	p.E90K
KARPAS45_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	19186263	19187027	19186830	19186830	Missense_Mutation	T	C	p.L133P
SKMEL2_SKIN	19186263	19187027	19186884	19186884	Missense_Mutation	A	G	p.K151R
DU145_PROSTATE	19186263	19187027	19186961	19186961	Missense_Mutation	C	A	p.L177I
LS411N_LARGE_INTESTINE	19186263	19187027	19187000	19187000	Missense_Mutation	G	A	p.G190R
HEC59_ENDOMETRIUM	19186263	19187027	19187025	19187025	Missense_Mutation	G	A	p.G198D
KP4_PANCREAS	19188933	19189103	19188945	19188945	Missense_Mutation	C	T	p.S203L
RL952_ENDOMETRIUM	19188933	19189103	19188963	19188963	Missense_Mutation	G	A	p.R209H
HEC59_ENDOMETRIUM	19188933	19189103	19189061	19189061	Missense_Mutation	G	A	p.D242N
HT55_LARGE_INTESTINE	19188933	19189103	19189071	19189071	Missense_Mutation	A	T	p.Q245L
NALM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	19188933	19189103	19189092	19189092	Missense_Mutation	G	A	p.R252H
NCIH2227_LUNG	19188933	19189103	19189094	19189094	Missense_Mutation	G	T	p.A253S
PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	19216439	19216592	19216505	19216505	Missense_Mutation	T	C	p.W354R
PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	19216418	19216592	19216505	19216505	Missense_Mutation	T	C	p.W354R
PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	19216436	19216592	19216505	19216505	Missense_Mutation	T	C	p.W354R
LI7_LIVER	19216439	19216592	19216587	19216587	Missense_Mutation	C	T	p.S381L
LI7_LIVER	19216418	19216592	19216587	19216587	Missense_Mutation	C	T	p.S381L
LI7_LIVER	19216436	19216592	19216587	19216587	Missense_Mutation	C	T	p.S381L
SKUT1_SOFT_TISSUE	19232874	19232960	19232943	19232943	Missense_Mutation	G	A	p.R465Q
NCIH630_LARGE_INTESTINE	19235166	19235381	19235211	19235211	Missense_Mutation	G	A	p.S486N
HEC6_ENDOMETRIUM	19235166	19235381	19235303	19235303	Missense_Mutation	G	A	p.A517T
KM12_LARGE_INTESTINE	19186263	19187027	19186644	19186644	Nonsense_Mutation	G	A	p.W71*
JHUEM7_ENDOMETRIUM	19216418	19216592	19216419	19216419	Splice_Site	A	C	p.H325P

Top

Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for EPN2

sQTL information located at the skipped exons.

Exon skip ID

Chromosome

Three exons

Skippped exon

ENST

Cancer type

SNP id

Location

DNA change (ref/var)

P-value

Top

Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for EPN2

Top

Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for EPN2

Top

RelatedDrugs for EPN2

Approved drugs targeting this gene.
(DrugBank Version 5.1.0 2018-04-02)

Gene

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

RelatedDiseases for EPN2

Diseases associated with this gene.
(DisGeNet 4.0)

Gene

Disease ID

Disease name

# pubmeds

Source

	Gene summary
	Gene structures and expression levels
	Exon skipping events with PSIs in TCGA
	Exon skipping events with PSIs in GTEx
	Open reading frame (ORF) annotation in the exon skipping event
	Exon skipping events in the canonical protein sequence
	SNVs in the skipped exons with depth of coverage
	Splicing Quantitative Trait Loci (sQTLs) in the skipped exons
	Splicing Quantitative Trait Methylation (sQTM) in the skipped exon
	Related drugs with this gene
	Related diseases with this gene

Home

Download

Statistics

Landscape

Help

Contact

Gene summary for EPN2

Exon skipping events across known transcript of Ensembl for EPN2 from UCSC genome browser

Gene isoform structures and expression levels for EPN2

Exon skipping events with PSIs in TCGA for EPN2

Exon skipping events with PSIs in GTEx for EPN2

Open reading frame (ORF) annotation in the exon skipping event for EPN2

Infer the effects of exon skipping event on protein functional features for EPN2

SNVs in the skipped exons for EPN2

Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for EPN2

Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for EPN2

Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for EPN2

RelatedDrugs for EPN2

RelatedDiseases for EPN2