|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for DSG2 |
 Gene summary |
| Gene information | Gene symbol | DSG2 | Gene ID | 1829 |
| Gene name | desmoglein 2 | |
| Synonyms | CDHF5|HDGC | |
| Cytomap | 18q12.1 | |
| Type of gene | protein-coding | |
| Description | desmoglein-2cadherin family member 5 | |
| Modification date | 20180519 | |
| UniProtAcc | Q14126 | |
| Context | PubMed: DSG2 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| DSG2 | GO:0007155 | cell adhesion | 17559062 |
| DSG2 | GO:0007156 | homophilic cell adhesion via plasma membrane adhesion molecules | 17559062 |
Top |
Exon skipping events across known transcript of Ensembl for DSG2 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for DSG2 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for DSG2 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_296221 | 18 | 29078182:29078259:29098201:29098237:29099765:29099900 | 29098201:29098237 | ENSG00000046604.8 | ENST00000585206.1 |
| exon_skip_296222 | 18 | 29099765:29099900:29100765:29100927:29101061:29101206 | 29100765:29100927 | ENSG00000046604.8 | ENST00000261590.8,ENST00000585206.1 |
| exon_skip_296226 | 18 | 29102045:29102212:29104410:29104548:29104665:29104851 | 29104410:29104548 | ENSG00000046604.8 | ENST00000261590.8 |
| exon_skip_296227 | 18 | 29110949:29111215:29115232:29115375:29116164:29116392 | 29115232:29115375 | ENSG00000046604.8 | ENST00000261590.8 |
| exon_skip_296231 | 18 | 29121155:29121277:29122482:29122815:29125683:29128971 | 29122482:29122815 | ENSG00000046604.8 | ENST00000261590.8 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for DSG2 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_296221 | 18 | 29078182:29078259:29098201:29098237:29099765:29099900 | 29098201:29098237 | ENSG00000046604.8 | ENST00000585206.1 |
| exon_skip_296222 | 18 | 29099765:29099900:29100765:29100927:29101061:29101206 | 29100765:29100927 | ENSG00000046604.8 | ENST00000261590.8,ENST00000585206.1 |
| exon_skip_296226 | 18 | 29102045:29102212:29104410:29104548:29104665:29104851 | 29104410:29104548 | ENSG00000046604.8 | ENST00000261590.8 |
| exon_skip_296227 | 18 | 29110949:29111215:29115232:29115375:29116164:29116392 | 29115232:29115375 | ENSG00000046604.8 | ENST00000261590.8 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for DSG2 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000261590 | 29115232 | 29115375 | Frame-shift |
| ENST00000261590 | 29100765 | 29100927 | In-frame |
| ENST00000261590 | 29104410 | 29104548 | In-frame |
| ENST00000261590 | 29122482 | 29122815 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000261590 | 29115232 | 29115375 | Frame-shift |
| ENST00000261590 | 29100765 | 29100927 | In-frame |
| ENST00000261590 | 29104410 | 29104548 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for DSG2 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000261590 | 5848 | 1118 | 29100765 | 29100927 | 426 | 587 | 72 | 126 |
| ENST00000261590 | 5848 | 1118 | 29104410 | 29104548 | 900 | 1037 | 230 | 276 |
| ENST00000261590 | 5848 | 1118 | 29122482 | 29122815 | 2211 | 2543 | 667 | 778 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000261590 | 5848 | 1118 | 29100765 | 29100927 | 426 | 587 | 72 | 126 |
| ENST00000261590 | 5848 | 1118 | 29104410 | 29104548 | 900 | 1037 | 230 | 276 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q14126 | 72 | 126 | 86 | 91 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5ERD |
| Q14126 | 72 | 126 | 95 | 98 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5ERD |
| Q14126 | 72 | 126 | 100 | 104 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5ERD |
| Q14126 | 72 | 126 | 110 | 113 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5ERD |
| Q14126 | 72 | 126 | 123 | 132 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5ERD |
| Q14126 | 72 | 126 | 50 | 1118 | Chain | ID=PRO_0000003846;Note=Desmoglein-2 |
| Q14126 | 72 | 126 | 50 | 160 | Domain | Note=Cadherin 1;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00043 |
| Q14126 | 72 | 126 | 112 | 112 | Glycosylation | Note=N-linked (GlcNAc...) asparagine;Ontology_term=ECO:0000269,ECO:0000269;evidence=ECO:0000269|PubMed:12754519,ECO:0000269|PubMed:19159218;Dbxref=PMID:12754519,PMID:19159218 |
| Q14126 | 72 | 126 | 89 | 89 | Natural variant | ID=VAR_048508;Note=Y->C;Dbxref=dbSNP:rs2230232 |
| Q14126 | 72 | 126 | 50 | 609 | Topological domain | Note=Extracellular;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| Q14126 | 72 | 126 | 76 | 82 | Turn | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5ERD |
| Q14126 | 72 | 126 | 92 | 94 | Turn | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5ERD |
| Q14126 | 72 | 126 | 106 | 108 | Turn | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5ERD |
| Q14126 | 72 | 126 | 119 | 121 | Turn | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5ERD |
| Q14126 | 230 | 276 | 233 | 242 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5ERD |
| Q14126 | 230 | 276 | 257 | 263 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5ERD |
| Q14126 | 230 | 276 | 50 | 1118 | Chain | ID=PRO_0000003846;Note=Desmoglein-2 |
| Q14126 | 230 | 276 | 161 | 273 | Domain | Note=Cadherin 2;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00043 |
| Q14126 | 230 | 276 | 274 | 388 | Domain | Note=Cadherin 3;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00043 |
| Q14126 | 230 | 276 | 50 | 609 | Topological domain | Note=Extracellular;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| Q14126 | 230 | 276 | 229 | 231 | Turn | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5ERD |
| Q14126 | 667 | 778 | 50 | 1118 | Chain | ID=PRO_0000003846;Note=Desmoglein-2 |
| Q14126 | 667 | 778 | 680 | 680 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244,ECO:0000244,ECO:0000244,ECO:0000244,ECO:0000244,ECO:0000244,ECO:0000244,ECO:0000244;evidence=ECO:0000244|PubMed:17081983,ECO:0000244|PubMed:18669648,ECO:0000244|PubMed:18691976,ECO:0000244|PubMed:19690332,ECO:0 |
| Q14126 | 667 | 778 | 700 | 700 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:24275569;Dbxref=PMID:24275569 |
| Q14126 | 667 | 778 | 703 | 703 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:21406692;Dbxref=PMID:21406692 |
| Q14126 | 667 | 778 | 723 | 723 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:23186163;Dbxref=PMID:23186163 |
| Q14126 | 667 | 778 | 726 | 726 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:23186163;Dbxref=PMID:23186163 |
| Q14126 | 667 | 778 | 713 | 713 | Natural variant | ID=VAR_062389;Note=E->K;Ontology_term=ECO:0000269,ECO:0000269;evidence=ECO:0000269|PubMed:18678517,ECO:0000269|PubMed:19863551;Dbxref=dbSNP:rs79241126,PMID:18678517,PMID:19863551 |
| Q14126 | 667 | 778 | 773 | 773 | Natural variant | ID=VAR_048511;Note=R->K;Ontology_term=ECO:0000269,ECO:0000269;evidence=ECO:0000269|PubMed:18678517,ECO:0000269|PubMed:19863551;Dbxref=dbSNP:rs2278792,PMID:18678517,PMID:19863551 |
| Q14126 | 667 | 778 | 635 | 1118 | Topological domain | Note=Cytoplasmic;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q14126 | 72 | 126 | 86 | 91 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5ERD |
| Q14126 | 72 | 126 | 95 | 98 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5ERD |
| Q14126 | 72 | 126 | 100 | 104 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5ERD |
| Q14126 | 72 | 126 | 110 | 113 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5ERD |
| Q14126 | 72 | 126 | 123 | 132 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5ERD |
| Q14126 | 72 | 126 | 50 | 1118 | Chain | ID=PRO_0000003846;Note=Desmoglein-2 |
| Q14126 | 72 | 126 | 50 | 160 | Domain | Note=Cadherin 1;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00043 |
| Q14126 | 72 | 126 | 112 | 112 | Glycosylation | Note=N-linked (GlcNAc...) asparagine;Ontology_term=ECO:0000269,ECO:0000269;evidence=ECO:0000269|PubMed:12754519,ECO:0000269|PubMed:19159218;Dbxref=PMID:12754519,PMID:19159218 |
| Q14126 | 72 | 126 | 89 | 89 | Natural variant | ID=VAR_048508;Note=Y->C;Dbxref=dbSNP:rs2230232 |
| Q14126 | 72 | 126 | 50 | 609 | Topological domain | Note=Extracellular;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| Q14126 | 72 | 126 | 76 | 82 | Turn | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5ERD |
| Q14126 | 72 | 126 | 92 | 94 | Turn | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5ERD |
| Q14126 | 72 | 126 | 106 | 108 | Turn | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5ERD |
| Q14126 | 72 | 126 | 119 | 121 | Turn | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5ERD |
| Q14126 | 230 | 276 | 233 | 242 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5ERD |
| Q14126 | 230 | 276 | 257 | 263 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5ERD |
| Q14126 | 230 | 276 | 50 | 1118 | Chain | ID=PRO_0000003846;Note=Desmoglein-2 |
| Q14126 | 230 | 276 | 161 | 273 | Domain | Note=Cadherin 2;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00043 |
| Q14126 | 230 | 276 | 274 | 388 | Domain | Note=Cadherin 3;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00043 |
| Q14126 | 230 | 276 | 50 | 609 | Topological domain | Note=Extracellular;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| Q14126 | 230 | 276 | 229 | 231 | Turn | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5ERD |
Top |
SNVs in the skipped exons for DSG2 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
DSG2_HNSC_exon_skip_296226_psi_boxplot.png |
DSG2_LUAD_exon_skip_296226_psi_boxplot.png |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| STAD | TCGA-HU-A4H0-01 | exon_skip_296222 | 29100766 | 29100927 | 29100918 | 29100919 | Frame_Shift_Ins | - | T | p.P123fs |
| SKCM | TCGA-GN-A265-06 | exon_skip_296222 | 29100766 | 29100927 | 29100904 | 29100904 | Nonsense_Mutation | C | T | p.R119* |
| HNSC | TCGA-CR-7368-01 | exon_skip_296226 | 29104411 | 29104548 | 29104495 | 29104495 | Nonsense_Mutation | C | T | p.Q259* |
| UCEC | TCGA-AP-A056-01 | exon_skip_296231 | 29122483 | 29122815 | 29122789 | 29122789 | Nonsense_Mutation | G | T | p.E770* |
| LUAD | TCGA-50-6595-01 | exon_skip_296226 | 29104411 | 29104548 | 29104409 | 29104409 | Splice_Site | A | G | p.E231_splice |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
 | Sample: TCGA-50-6595-01 |
| Cancer type: LUAD | |
| ESID: exon_skip_296226 | |
| Skipped exon start: 29104411 | |
| Skipped exon end: 29104548 | |
| Mutation start: 29104409 | |
| Mutation end: 29104409 | |
| Mutation type: Splice_Site | |
| Reference seq: A | |
| Mutation seq: G | |
| AAchange: p.E231_splice | |
exon_skip_296226_LUAD_TCGA-50-6595-01.png | |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| EN_ENDOMETRIUM | 29100766 | 29100927 | 29100918 | 29100919 | Frame_Shift_Ins | - | T | p.F124fs |
| COV318_OVARY | 29098202 | 29098237 | 29098214 | 29098214 | Missense_Mutation | G | A | p.V20I |
| SARC9371_BONE | 29098202 | 29098237 | 29098223 | 29098223 | Missense_Mutation | G | A | p.G23R |
| U118MG_CENTRAL_NERVOUS_SYSTEM | 29100766 | 29100927 | 29100839 | 29100839 | Missense_Mutation | C | G | p.P97R |
| SW872_SOFT_TISSUE | 29100766 | 29100927 | 29100854 | 29100854 | Missense_Mutation | T | C | p.F102S |
| KASUMI2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 29100766 | 29100927 | 29100905 | 29100905 | Missense_Mutation | G | A | p.R119Q |
| KM12_LARGE_INTESTINE | 29104411 | 29104548 | 29104450 | 29104450 | Missense_Mutation | G | A | p.G244S |
| LC1SQ_LUNG | 29115233 | 29115375 | 29115300 | 29115300 | Missense_Mutation | G | C | p.A450P |
| SNU1040_LARGE_INTESTINE | 29115233 | 29115375 | 29115331 | 29115331 | Missense_Mutation | T | C | p.V460A |
| OVCA433_OVARY | 29122483 | 29122815 | 29122489 | 29122489 | Missense_Mutation | C | T | p.P670S |
| OVTOKO_OVARY | 29122483 | 29122815 | 29122507 | 29122507 | Missense_Mutation | G | A | p.D676N |
| PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 29122483 | 29122815 | 29122595 | 29122595 | Missense_Mutation | T | C | p.V705A |
| MOLT3_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 29122483 | 29122815 | 29122690 | 29122690 | Missense_Mutation | G | T | p.G737C |
| MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 29122483 | 29122815 | 29122690 | 29122690 | Missense_Mutation | G | T | p.G737C |
| KPNSI9S_AUTONOMIC_GANGLIA | 29122483 | 29122815 | 29122723 | 29122723 | Missense_Mutation | G | A | p.A748T |
| LC1SQSF_LUNG | 29115233 | 29115375 | 29111214 | 29115230 | Splice_Site | AGGTAAGAGAGAGTGACACGTGTATTTCTTTATTTTAAATTATTTTCAGTGCCTATTTTCAAAAATCATAATCAAATCTGAACACTTCATTCCTTCAAATCCAGCATTATAGTTCCCCAAAGGTCTACAAGTTAAATTTTCCAAAGATGTGTCTATAACTGAGAGATGAGGGGGAATTTTCACCAGAATCCACCTTCTTCAACCACCTGTGTGTGAGGAGGAAGTTAGTTTACTCACCACTGAAACAGTTCTGGC | - | p.R427del |
| 451LU_SKIN | 29115233 | 29115375 | 29115233 | 29115233 | Splice_Site | A | T | p.R427S |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for DSG2 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for DSG2 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for DSG2 |
Top |
RelatedDrugs for DSG2 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for DSG2 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| DSG2 | C1857777 | Arrhythmogenic Right Ventricular Dysplasia, Familial, 10 | 2 | CTD_human;UNIPROT |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|