|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for KLF6 |
 Gene summary |
| Gene information | Gene symbol | KLF6 | Gene ID | 1316 |
| Gene name | Kruppel like factor 6 | |
| Synonyms | BCD1|CBA1|COPEB|CPBP|GBF|PAC1|ST12|ZF9 | |
| Cytomap | 10p15.2 | |
| Type of gene | protein-coding | |
| Description | Krueppel-like factor 6B-cell-derived protein 1GC-rich binding factorGC-rich sites-binding factor GBFKruppel-like zinc finger protein Zf9core promoter element-binding proteinproto-oncogene BCD1protooncogene B-cell derived 1suppression of tumorigeni | |
| Modification date | 20180523 | |
| UniProtAcc | Q99612 | |
| Context | PubMed: KLF6 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| KLF6 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 18755691 |
Top |
Exon skipping events across known transcript of Ensembl for KLF6 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for KLF6 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for KLF6 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_46751 | 10 | 3821741:3821782:3822297:3822421:3823832:3824406 | 3822297:3822421 | ENSG00000067082.10 | ENST00000497571.1 |
| exon_skip_46753 | 10 | 3821741:3821782:3822297:3822421:3823986:3824243 | 3822297:3822421 | ENSG00000067082.10 | ENST00000173785.4 |
| exon_skip_46759 | 10 | 3823999:3824406:3825407:3825473:3827104:3827375 | 3825407:3825473 | ENSG00000067082.10 | ENST00000380946.3 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for KLF6 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_46751 | 10 | 3821741:3821782:3822297:3822421:3823832:3824406 | 3822297:3822421 | ENSG00000067082.10 | ENST00000497571.1 |
| exon_skip_46753 | 10 | 3821741:3821782:3822297:3822421:3823986:3824243 | 3822297:3822421 | ENSG00000067082.10 | ENST00000173785.4 |
| exon_skip_46759 | 10 | 3823999:3824406:3825407:3825473:3827104:3827375 | 3825407:3825473 | ENSG00000067082.10 | ENST00000380946.3 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for KLF6 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000497571 | 3822297 | 3822421 | Frame-shift |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000497571 | 3822297 | 3822421 | Frame-shift |
Top |
Infer the effects of exon skipping event on protein functional features for KLF6 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
Top |
SNVs in the skipped exons for KLF6 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| UCS | TCGA-ND-A4W6-01 | exon_skip_46753 exon_skip_46751 | 3822298 | 3822421 | 3822356 | 3822356 | Frame_Shift_Del | T | - | p.T248fs |
| SKCM | TCGA-EE-A2GR-06 | exon_skip_46753 exon_skip_46751 | 3822298 | 3822421 | 3822344 | 3822344 | Nonsense_Mutation | G | A | p.R210X |
| SKCM | TCGA-EE-A2GR-06 | exon_skip_46753 exon_skip_46751 | 3822298 | 3822421 | 3822344 | 3822344 | Nonsense_Mutation | G | A | p.R252* |
| UCEC | TCGA-D1-A17H-01 | exon_skip_46753 exon_skip_46751 | 3822298 | 3822421 | 3822344 | 3822344 | Nonsense_Mutation | G | A | p.R252* |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
 | Sample: TCGA-EE-A2GR-06 |
| Cancer type: SKCM | |
| ESID: exon_skip_46751 | |
| Skipped exon start: 3822298 | |
| Skipped exon end: 3822421 | |
| Mutation start: 3822344 | |
| Mutation end: 3822344 | |
| Mutation type: Nonsense_Mutation | |
| Reference seq: G | |
| Mutation seq: A | |
| AAchange: p.R210X | |
| Sample: TCGA-EE-A2GR-06 |
| Cancer type: SKCM | |
| ESID: exon_skip_46751 | |
| Skipped exon start: 3822298 | |
| Skipped exon end: 3822421 | |
| Mutation start: 3822344 | |
| Mutation end: 3822344 | |
| Mutation type: Nonsense_Mutation | |
| Reference seq: G | |
| Mutation seq: A | |
| AAchange: p.R252* | |
exon_skip_125948_SKCM_TCGA-EE-A2GR-06.png | |
exon_skip_144125_SKCM_TCGA-EE-A2GR-06.png | |
exon_skip_382100_SKCM_TCGA-EE-A2GR-06.png | |
exon_skip_46753_SKCM_TCGA-EE-A2GR-06.png | |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| CAL62_THYROID | 3822298 | 3822421 | 3822362 | 3822381 | Frame_Shift_Del | CATCACTTCTTGCAAAACGC | - | p.WRFARSDE239fs |
| CTV1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 3822298 | 3822421 | 3822332 | 3822332 | Missense_Mutation | C | T | p.G256R |
| KP2_PANCREAS | 3822298 | 3822421 | 3822362 | 3822362 | Missense_Mutation | C | T | p.E246K |
| MCAS_OVARY | 3822298 | 3822421 | 3822362 | 3822362 | Missense_Mutation | C | T | p.E246K |
| NCIH2228_LUNG | 3822298 | 3822421 | 3822362 | 3822362 | Missense_Mutation | C | T | p.E246K |
| BB65EBV_MATCHED_NORMAL_TISSUE | 3822298 | 3822421 | 3822418 | 3822418 | Missense_Mutation | T | C | p.E227G |
| HMC18_BREAST | 3822298 | 3822421 | 3822344 | 3822344 | Nonsense_Mutation | G | A | p.R252* |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for KLF6 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for KLF6 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for KLF6 |
Top |
RelatedDrugs for KLF6 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for KLF6 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| KLF6 | C0023893 | Liver Cirrhosis, Experimental | 1 | CTD_human |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|