|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for CYP4F22 |
 Gene summary |
| Gene information | Gene symbol | CYP4F22 | Gene ID | 126410 |
| Gene name | cytochrome P450 family 4 subfamily F member 22 | |
| Synonyms | ARCI5|INLNE|LI3 | |
| Cytomap | 19p13.12 | |
| Type of gene | protein-coding | |
| Description | cytochrome P450 4F22cytochrome P450, family 2, subfamily E, polypeptide 2 homologcytochrome P450, family 4, subfamily F, polypeptide 22 | |
| Modification date | 20180329 | |
| UniProtAcc | Q6NT55 | |
| Context | PubMed: CYP4F22 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for CYP4F22 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for CYP4F22 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for CYP4F22 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_303082 | 19 | 15648682:15648804:15651260:15651528:15654781:15654848 | 15651260:15651528 | ENSG00000171954.8 | ENST00000601005.2,ENST00000269703.3 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for CYP4F22 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_303082 | 19 | 15648682:15648804:15651260:15651528:15654781:15654848 | 15651260:15651528 | ENSG00000171954.8 | ENST00000269703.3,ENST00000601005.2 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for CYP4F22 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000269703 | 15651260 | 15651528 | Frame-shift |
| ENST00000601005 | 15651260 | 15651528 | Frame-shift |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000269703 | 15651260 | 15651528 | Frame-shift |
| ENST00000601005 | 15651260 | 15651528 | Frame-shift |
Top |
Infer the effects of exon skipping event on protein functional features for CYP4F22 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
Top |
SNVs in the skipped exons for CYP4F22 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| ESCA | TCGA-L5-A8NI-01 | exon_skip_303082 | 15651261 | 15651528 | 15651362 | 15651381 | Frame_Shift_Del | CGGCGGATGGGCGGAGGTTC | - | p.258_264del |
| ESCA | TCGA-L5-A8NI-01 | exon_skip_303082 | 15651261 | 15651528 | 15651362 | 15651381 | Frame_Shift_Del | CGGCGGATGGGCGGAGGTTC | - | p.SADGRRF258fs |
| HNSC | TCGA-CR-7402-01 | exon_skip_303082 | 15651261 | 15651528 | 15651434 | 15651434 | Frame_Shift_Del | G | - | p.R282fs |
| HNSC | TCGA-CR-7402-01 | exon_skip_303082 | 15651261 | 15651528 | 15651434 | 15651434 | Frame_Shift_Del | G | - | p.R284fs |
| SKCM | TCGA-EE-A182-06 | exon_skip_303082 | 15651261 | 15651528 | 15651427 | 15651427 | Nonsense_Mutation | C | T | p.Q280* |
| SKCM | TCGA-EE-A182-06 | exon_skip_303082 | 15651261 | 15651528 | 15651427 | 15651427 | Nonsense_Mutation | C | T | p.Q280X |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| NCIH1770_LUNG | 15651261 | 15651528 | 15651281 | 15651281 | Missense_Mutation | C | T | p.S231F |
| SW1271_LUNG | 15651261 | 15651528 | 15651317 | 15651317 | Missense_Mutation | G | T | p.R243L |
| UACC812_BREAST | 15651261 | 15651528 | 15651401 | 15651401 | Missense_Mutation | T | C | p.V271A |
| M14_SKIN | 15651261 | 15651528 | 15651430 | 15651430 | Missense_Mutation | G | A | p.E281K |
| CORL303_LUNG | 15651261 | 15651528 | 15651440 | 15651440 | Missense_Mutation | G | A | p.R284Q |
| MFE319_ENDOMETRIUM | 15651261 | 15651528 | 15651452 | 15651452 | Missense_Mutation | A | G | p.Q288R |
| DG75_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 15651261 | 15651528 | 15651482 | 15651482 | Missense_Mutation | A | G | p.K298R |
| REH_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 15651261 | 15651528 | 15651501 | 15651501 | Missense_Mutation | C | G | p.D304E |
| DG75_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 15651261 | 15651528 | 15651470 | 15651470 | Nonsense_Mutation | G | A | p.W294* |
| YD10B_UPPER_AERODIGESTIVE_TRACT | 15651261 | 15651528 | 15651527 | 15651527 | Splice_Site | G | T | p.R313M |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for CYP4F22 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for CYP4F22 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for CYP4F22 |
Top |
RelatedDrugs for CYP4F22 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for CYP4F22 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| CYP4F22 | C1858133 | Ichthyosis, Nonlamellar and Nonerythrodermic, Congenital, Autosomal Recessive | 1 | UNIPROT |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|