|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for ECD |
 Gene summary |
| Gene information | Gene symbol | ECD | Gene ID | 11319 |
| Gene name | ecdysoneless cell cycle regulator | |
| Synonyms | GCR2|HSGT1|SGT1 | |
| Cytomap | 10q22.2 | |
| Type of gene | protein-coding | |
| Description | protein ecdysoneless homologecdysoneless homologhuman suppressor of GCR twoprotein SGT1suppressor of GCR2suppressor of S. cerevisiae gcr2 | |
| Modification date | 20180523 | |
| UniProtAcc | O95905 | |
| Context | PubMed: ECD [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| ECD | GO:0045944 | positive regulation of transcription by RNA polymerase II | 19919181 |
Top |
Exon skipping events across known transcript of Ensembl for ECD from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for ECD |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for ECD |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_50921 | 10 | 74896461:74896676:74897760:74897828:74899066:74899253 | 74897760:74897828 | ENSG00000122882.6 | ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000484976.2 |
| exon_skip_50925 | 10 | 74899388:74899495:74901144:74901243:74906033:74906109 | 74901144:74901243 | ENSG00000122882.6 | ENST00000430082.2 |
| exon_skip_50927 | 10 | 74899388:74899495:74906033:74906119:74908033:74908162 | 74906033:74906119 | ENSG00000122882.6 | ENST00000454759.2,ENST00000372979.4,ENST00000484976.2 |
| exon_skip_50928 | 10 | 74908033:74908162:74912050:74912179:74914013:74914153 | 74912050:74912179 | ENSG00000122882.6 | ENST00000430082.2,ENST00000372979.4 |
| exon_skip_50930 | 10 | 74912103:74912179:74914013:74914206:74916032:74916211 | 74914013:74914206 | ENSG00000122882.6 | ENST00000453402.1,ENST00000430082.2,ENST00000372979.4 |
| exon_skip_50932 | 10 | 74914067:74914206:74916032:74916211:74916325:74916335 | 74916032:74916211 | ENSG00000122882.6 | ENST00000453402.1,ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000413026.1 |
| exon_skip_50934 | 10 | 74916346:74916413:74920191:74920309:74927623:74927706 | 74920191:74920309 | ENSG00000122882.6 | ENST00000453402.1,ENST00000484976.2 |
| exon_skip_50937 | 10 | 74920203:74920309:74923490:74923708:74927623:74927706 | 74923490:74923708 | ENSG00000122882.6 | ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000413026.1 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for ECD |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_50921 | 10 | 74896461:74896676:74897760:74897828:74899066:74899253 | 74897760:74897828 | ENSG00000122882.6 | ENST00000372979.4,ENST00000484976.2,ENST00000454759.2,ENST00000430082.2 |
| exon_skip_50925 | 10 | 74899388:74899495:74901144:74901243:74906033:74906109 | 74901144:74901243 | ENSG00000122882.6 | ENST00000430082.2 |
| exon_skip_50927 | 10 | 74899388:74899495:74906033:74906119:74908033:74908162 | 74906033:74906119 | ENSG00000122882.6 | ENST00000372979.4,ENST00000484976.2,ENST00000454759.2 |
| exon_skip_50928 | 10 | 74908033:74908162:74912050:74912179:74914013:74914153 | 74912050:74912179 | ENSG00000122882.6 | ENST00000372979.4,ENST00000430082.2 |
| exon_skip_50930 | 10 | 74912103:74912179:74914013:74914206:74916032:74916211 | 74914013:74914206 | ENSG00000122882.6 | ENST00000372979.4,ENST00000430082.2,ENST00000453402.1 |
| exon_skip_50932 | 10 | 74914067:74914206:74916032:74916211:74916325:74916335 | 74916032:74916211 | ENSG00000122882.6 | ENST00000372979.4,ENST00000454759.2,ENST00000430082.2,ENST00000453402.1,ENST00000413026.1 |
| exon_skip_50934 | 10 | 74916346:74916413:74920191:74920309:74927623:74927706 | 74920191:74920309 | ENSG00000122882.6 | ENST00000484976.2,ENST00000453402.1 |
| exon_skip_50937 | 10 | 74920203:74920309:74923490:74923708:74927623:74927706 | 74923490:74923708 | ENSG00000122882.6 | ENST00000372979.4,ENST00000454759.2,ENST00000430082.2,ENST00000413026.1 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for ECD |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000372979 | 74923490 | 74923708 | 3UTR-3CDS |
| ENST00000372979 | 74897760 | 74897828 | Frame-shift |
| ENST00000372979 | 74906033 | 74906119 | Frame-shift |
| ENST00000372979 | 74914013 | 74914206 | Frame-shift |
| ENST00000372979 | 74916032 | 74916211 | Frame-shift |
| ENST00000372979 | 74912050 | 74912179 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000372979 | 74923490 | 74923708 | 3UTR-3CDS |
| ENST00000372979 | 74897760 | 74897828 | Frame-shift |
| ENST00000372979 | 74906033 | 74906119 | Frame-shift |
| ENST00000372979 | 74914013 | 74914206 | Frame-shift |
| ENST00000372979 | 74916032 | 74916211 | Frame-shift |
| ENST00000372979 | 74912050 | 74912179 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for ECD |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000372979 | 3086 | 644 | 74912050 | 74912179 | 991 | 1119 | 261 | 304 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000372979 | 3086 | 644 | 74912050 | 74912179 | 991 | 1119 | 261 | 304 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| O95905 | 261 | 304 | 262 | 304 | Alternative sequence | ID=VSP_045670;Note=In isoform 2. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|Ref.3 |
| O95905 | 261 | 304 | 1 | 644 | Chain | ID=PRO_0000220844;Note=Protein ecdysoneless homolog |
| O95905 | 261 | 304 | 281 | 281 | Natural variant | ID=VAR_012191;Note=Could be a rare polymorphism. R->G;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:11090341;Dbxref=dbSNP:rs151023501,PMID:11090341 |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| O95905 | 261 | 304 | 262 | 304 | Alternative sequence | ID=VSP_045670;Note=In isoform 2. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|Ref.3 |
| O95905 | 261 | 304 | 1 | 644 | Chain | ID=PRO_0000220844;Note=Protein ecdysoneless homolog |
| O95905 | 261 | 304 | 281 | 281 | Natural variant | ID=VAR_012191;Note=Could be a rare polymorphism. R->G;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:11090341;Dbxref=dbSNP:rs151023501,PMID:11090341 |
Top |
SNVs in the skipped exons for ECD |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
ECD_STAD_exon_skip_50930_psi_boxplot.png |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_50921 | 74897761 | 74897828 | 74897786 | 74897786 | Frame_Shift_Del | A | - | p.F488fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_50932 | 74916033 | 74916211 | 74916082 | 74916082 | Frame_Shift_Del | T | - | p.I181fs |
| KIRP | TCGA-5P-A9K6-01 | exon_skip_50934 | 74920192 | 74920309 | 74920304 | 74920308 | Frame_Shift_Del | CACCT | - | p.70_71del |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_50937 | 74923491 | 74923708 | 74923686 | 74923686 | Frame_Shift_Del | T | - | p.T4fs |
| STAD | TCGA-FP-8631-01 | exon_skip_50930 | 74914014 | 74914206 | 74914192 | 74914193 | Frame_Shift_Ins | - | T | p.I202fs |
| STAD | TCGA-BR-6565-01 | exon_skip_50927 | 74906034 | 74906119 | 74906052 | 74906052 | Nonsense_Mutation | G | C | p.S370* |
| STAD | TCGA-BR-6565-01 | exon_skip_50927 | 74906034 | 74906119 | 74906052 | 74906052 | Nonsense_Mutation | G | C | p.S370X |
| HNSC | TCGA-CN-A6V1-01 | exon_skip_50930 | 74914014 | 74914206 | 74914175 | 74914175 | Nonsense_Mutation | G | A | p.R208* |
| KIRP | TCGA-5P-A9K6-01 | exon_skip_50934 | 74920192 | 74920309 | 74920311 | 74920311 | Splice_Site | T | G | . |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
 | Sample: TCGA-FP-8631-01 |
| Cancer type: STAD | |
| ESID: exon_skip_50930 | |
| Skipped exon start: 74914014 | |
| Skipped exon end: 74914206 | |
| Mutation start: 74914192 | |
| Mutation end: 74914193 | |
| Mutation type: Frame_Shift_Ins | |
| Reference seq: - | |
| Mutation seq: T | |
| AAchange: p.I202fs | |
exon_skip_50930_STAD_TCGA-FP-8631-01.png | |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| MDAMB453_BREAST | 74906034 | 74906119 | 74906084 | 74906105 | Frame_Shift_Del | CCTTTCCCGGTACTGAGCAGAA | - | p.GSAQYRER352fs |
| HCC2998_LARGE_INTESTINE | 74897761 | 74897828 | 74897790 | 74897790 | Missense_Mutation | G | T | p.S487Y |
| SNGM_ENDOMETRIUM | 74897761 | 74897828 | 74897796 | 74897796 | Missense_Mutation | G | A | p.A485V |
| KM12_LARGE_INTESTINE | 74914014 | 74914206 | 74914106 | 74914106 | Missense_Mutation | C | T | p.A231T |
| HEC265_ENDOMETRIUM | 74914014 | 74914206 | 74914138 | 74914138 | Missense_Mutation | A | G | p.V220A |
| MOLT3_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 74916033 | 74916211 | 74916043 | 74916043 | Missense_Mutation | G | A | p.R194C |
| SNU1040_LARGE_INTESTINE | 74916033 | 74916211 | 74916043 | 74916043 | Missense_Mutation | G | A | p.R194C |
| 253JBV_URINARY_TRACT | 74916033 | 74916211 | 74916186 | 74916186 | Missense_Mutation | C | T | p.C146Y |
| HCC2998_LARGE_INTESTINE | 74916033 | 74916211 | 74916206 | 74916206 | Missense_Mutation | A | C | p.F139L |
| MFE319_ENDOMETRIUM | 74920192 | 74920309 | 74920238 | 74920238 | Missense_Mutation | A | T | p.Y93N |
| KMRC3_KIDNEY | 74920192 | 74920309 | 74920283 | 74920283 | Missense_Mutation | C | T | p.V78M |
| KARPAS45_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 74920192 | 74920309 | 74920304 | 74920304 | Missense_Mutation | C | T | p.V71I |
| AM38_CENTRAL_NERVOUS_SYSTEM | 74923491 | 74923708 | 74923525 | 74923525 | Missense_Mutation | A | C | p.N57K |
| HCT116_LARGE_INTESTINE | 74923491 | 74923708 | 74923608 | 74923608 | Missense_Mutation | T | C | p.K30E |
| KM12_LARGE_INTESTINE | 74912051 | 74912179 | 74912077 | 74912077 | Nonsense_Mutation | G | A | p.R296* |
| JHUEM7_ENDOMETRIUM | 74923491 | 74923708 | 74923694 | 74923694 | Start_Codon_SNP | A | G | p.M1T |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for ECD |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
| exon_skip_50937 | 10 | 74920203:74920309:74923490:74923708:74927623:74927706 | 74923490:74923708 | ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000413026.1 | CESC | rs3812619 | chr10:74923562 | C/T | 1.53e-04 |
| exon_skip_50937 | 10 | 74920203:74920309:74923490:74923708:74927623:74927706 | 74923490:74923708 | ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000413026.1 | HNSC | rs3812619 | chr10:74923562 | C/T | 8.19e-04 |
| exon_skip_50937 | 10 | 74920203:74920309:74923490:74923708:74927623:74927706 | 74923490:74923708 | ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000413026.1 | KIRP | rs3812619 | chr10:74923562 | C/T | 2.32e-04 |
| exon_skip_50937 | 10 | 74920203:74920309:74923490:74923708:74927623:74927706 | 74923490:74923708 | ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000413026.1 | LGG | rs3812619 | chr10:74923562 | C/T | 5.14e-04 |
| exon_skip_50937 | 10 | 74920203:74920309:74923490:74923708:74927623:74927706 | 74923490:74923708 | ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000413026.1 | KIRC | rs3812619 | chr10:74923562 | C/T | 2.59e-04 |
| exon_skip_50937 | 10 | 74920203:74920309:74923490:74923708:74927623:74927706 | 74923490:74923708 | ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000413026.1 | LUAD | rs3812619 | chr10:74923562 | C/T | 2.67e-03 |
| exon_skip_50937 | 10 | 74920203:74920309:74923490:74923708:74927623:74927706 | 74923490:74923708 | ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000413026.1 | LIHC | rs3812619 | chr10:74923562 | C/T | 5.65e-05 |
| exon_skip_50937 | 10 | 74920203:74920309:74923490:74923708:74927623:74927706 | 74923490:74923708 | ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000413026.1 | OV | rs3812619 | chr10:74923562 | C/T | 2.62e-06 |
| exon_skip_50937 | 10 | 74920203:74920309:74923490:74923708:74927623:74927706 | 74923490:74923708 | ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000413026.1 | PRAD | rs3812619 | chr10:74923562 | C/T | 1.09e-04 |
| exon_skip_50937 | 10 | 74920203:74920309:74923490:74923708:74927623:74927706 | 74923490:74923708 | ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000413026.1 | STAD | rs3812619 | chr10:74923562 | C/T | 1.18e-03 |
| exon_skip_50937 | 10 | 74920203:74920309:74923490:74923708:74927623:74927706 | 74923490:74923708 | ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000413026.1 | THCA | rs3812619 | chr10:74923562 | C/T | 2.74e-07 |
| exon_skip_50932 | 10 | 74914067:74914206:74916032:74916211:74916325:74916335 | 74916032:74916211 | ENST00000453402.1,ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000413026.1 | CESC | rs12241093 | chr10:74916173 | T/A | 6.90e-04 |
| exon_skip_50932 | 10 | 74914067:74914206:74916032:74916211:74916325:74916335 | 74916032:74916211 | ENST00000453402.1,ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000413026.1 | HNSC | rs12241093 | chr10:74916173 | T/A | 9.88e-04 |
| exon_skip_50932 | 10 | 74914067:74914206:74916032:74916211:74916325:74916335 | 74916032:74916211 | ENST00000453402.1,ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000413026.1 | BRCA | rs12241093 | chr10:74916173 | T/A | 2.79e-05 |
| exon_skip_50932 | 10 | 74914067:74914206:74916032:74916211:74916325:74916335 | 74916032:74916211 | ENST00000453402.1,ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000413026.1 | KIRP | rs12241093 | chr10:74916173 | T/A | 1.87e-04 |
| exon_skip_50932 | 10 | 74914067:74914206:74916032:74916211:74916325:74916335 | 74916032:74916211 | ENST00000453402.1,ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000413026.1 | LGG | rs12241093 | chr10:74916173 | T/A | 2.26e-03 |
| exon_skip_50932 | 10 | 74914067:74914206:74916032:74916211:74916325:74916335 | 74916032:74916211 | ENST00000453402.1,ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000413026.1 | KIRC | rs12241093 | chr10:74916173 | T/A | 4.32e-04 |
| exon_skip_50932 | 10 | 74914067:74914206:74916032:74916211:74916325:74916335 | 74916032:74916211 | ENST00000453402.1,ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000413026.1 | LUAD | rs12241093 | chr10:74916173 | T/A | 1.09e-03 |
| exon_skip_50932 | 10 | 74914067:74914206:74916032:74916211:74916325:74916335 | 74916032:74916211 | ENST00000453402.1,ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000413026.1 | LIHC | rs12241093 | chr10:74916173 | T/A | 9.82e-05 |
| exon_skip_50932 | 10 | 74914067:74914206:74916032:74916211:74916325:74916335 | 74916032:74916211 | ENST00000453402.1,ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000413026.1 | OV | rs12241093 | chr10:74916173 | T/A | 5.01e-05 |
| exon_skip_50932 | 10 | 74914067:74914206:74916032:74916211:74916325:74916335 | 74916032:74916211 | ENST00000453402.1,ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000413026.1 | PRAD | rs12241093 | chr10:74916173 | T/A | 2.49e-03 |
| exon_skip_50932 | 10 | 74914067:74914206:74916032:74916211:74916325:74916335 | 74916032:74916211 | ENST00000453402.1,ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000413026.1 | STAD | rs12241093 | chr10:74916173 | T/A | 6.34e-04 |
| exon_skip_50932 | 10 | 74914067:74914206:74916032:74916211:74916325:74916335 | 74916032:74916211 | ENST00000453402.1,ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000413026.1 | THCA | rs12241093 | chr10:74916173 | T/A | 2.15e-06 |
| exon_skip_50921 | 10 | 74896461:74896676:74897760:74897828:74899066:74899253 | 74897760:74897828 | ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000484976.2 | CESC | rs2271905 | chr10:74897816 | C/T | 2.52e-04 |
| exon_skip_50921 | 10 | 74896461:74896676:74897760:74897828:74899066:74899253 | 74897760:74897828 | ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000484976.2 | HNSC | rs2271905 | chr10:74897816 | C/T | 6.08e-04 |
| exon_skip_50921 | 10 | 74896461:74896676:74897760:74897828:74899066:74899253 | 74897760:74897828 | ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000484976.2 | KIRP | rs2271905 | chr10:74897816 | C/T | 2.32e-04 |
| exon_skip_50921 | 10 | 74896461:74896676:74897760:74897828:74899066:74899253 | 74897760:74897828 | ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000484976.2 | LGG | rs2271905 | chr10:74897816 | C/T | 5.98e-04 |
| exon_skip_50921 | 10 | 74896461:74896676:74897760:74897828:74899066:74899253 | 74897760:74897828 | ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000484976.2 | KIRC | rs2271905 | chr10:74897816 | C/T | 3.12e-04 |
| exon_skip_50921 | 10 | 74896461:74896676:74897760:74897828:74899066:74899253 | 74897760:74897828 | ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000484976.2 | LUAD | rs2271905 | chr10:74897816 | C/T | 2.29e-03 |
| exon_skip_50921 | 10 | 74896461:74896676:74897760:74897828:74899066:74899253 | 74897760:74897828 | ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000484976.2 | LIHC | rs2271905 | chr10:74897816 | C/T | 7.24e-05 |
| exon_skip_50921 | 10 | 74896461:74896676:74897760:74897828:74899066:74899253 | 74897760:74897828 | ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000484976.2 | PRAD | rs2271905 | chr10:74897816 | C/T | 1.09e-04 |
| exon_skip_50921 | 10 | 74896461:74896676:74897760:74897828:74899066:74899253 | 74897760:74897828 | ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000484976.2 | STAD | rs2271905 | chr10:74897816 | C/T | 8.62e-04 |
| exon_skip_50921 | 10 | 74896461:74896676:74897760:74897828:74899066:74899253 | 74897760:74897828 | ENST00000430082.2,ENST00000454759.2,ENST00000372979.4,ENST00000484976.2 | THCA | rs2271905 | chr10:74897816 | C/T | 2.74e-07 |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for ECD |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for ECD |
Top |
RelatedDrugs for ECD |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for ECD |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|