|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for XPOT |
 Gene summary |
| Gene information | Gene symbol | XPOT | Gene ID | 11260 |
| Gene name | exportin for tRNA | |
| Synonyms | XPO3 | |
| Cytomap | 12q14.2 | |
| Type of gene | protein-coding | |
| Description | exportin-Texportin(tRNA)exportin, tRNA (nuclear export receptor for tRNAs)tRNA exportin | |
| Modification date | 20180523 | |
| UniProtAcc | O43592 | |
| Context | PubMed: XPOT [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| XPOT | GO:0006409 | tRNA export from nucleus | 9660920 |
Top |
Exon skipping events across known transcript of Ensembl for XPOT from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for XPOT |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for XPOT |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_84929 | 12 | 64810477:64810534:64811825:64811895:64812655:64812874 | 64811825:64811895 | ENSG00000184575.7 | ENST00000332707.5,ENST00000400935.2 |
| exon_skip_84934 | 12 | 64814132:64814301:64815014:64815251:64816784:64816823 | 64815014:64815251 | ENSG00000184575.7 | ENST00000332707.5 |
| exon_skip_84939 | 12 | 64815014:64815251:64816784:64816823:64816961:64817024 | 64816784:64816823 | ENSG00000184575.7 | ENST00000332707.5 |
| exon_skip_84941 | 12 | 64818817:64818962:64819117:64819237:64819594:64819689 | 64819117:64819237 | ENSG00000184575.7 | ENST00000332707.5 |
| exon_skip_84944 | 12 | 64828286:64828403:64828573:64828689:64829406:64829454 | 64828573:64828689 | ENSG00000184575.7 | ENST00000332707.5 |
| exon_skip_84948 | 12 | 64829406:64829454:64833023:64833095:64838854:64838911 | 64833023:64833095 | ENSG00000184575.7 | ENST00000332707.5 |
| exon_skip_84952 | 12 | 64833023:64833095:64838854:64838911:64841884:64844907 | 64838854:64838911 | ENSG00000184575.7 | ENST00000332707.5 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for XPOT |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_84929 | 12 | 64810477:64810534:64811825:64811895:64812655:64812874 | 64811825:64811895 | ENSG00000184575.7 | ENST00000332707.5,ENST00000400935.2 |
| exon_skip_84934 | 12 | 64814132:64814301:64815014:64815251:64816784:64816823 | 64815014:64815251 | ENSG00000184575.7 | ENST00000332707.5 |
| exon_skip_84939 | 12 | 64815014:64815251:64816784:64816823:64816961:64817024 | 64816784:64816823 | ENSG00000184575.7 | ENST00000332707.5 |
| exon_skip_84941 | 12 | 64818817:64818962:64819117:64819237:64819594:64819689 | 64819117:64819237 | ENSG00000184575.7 | ENST00000332707.5 |
| exon_skip_84944 | 12 | 64828286:64828403:64828573:64828689:64829406:64829454 | 64828573:64828689 | ENSG00000184575.7 | ENST00000332707.5 |
| exon_skip_84948 | 12 | 64829406:64829454:64833023:64833095:64838854:64838911 | 64833023:64833095 | ENSG00000184575.7 | ENST00000332707.5 |
| exon_skip_84952 | 12 | 64833023:64833095:64838854:64838911:64841884:64844907 | 64838854:64838911 | ENSG00000184575.7 | ENST00000332707.5 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for XPOT |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000332707 | 64811825 | 64811895 | Frame-shift |
| ENST00000332707 | 64828573 | 64828689 | Frame-shift |
| ENST00000332707 | 64815014 | 64815251 | In-frame |
| ENST00000332707 | 64816784 | 64816823 | In-frame |
| ENST00000332707 | 64819117 | 64819237 | In-frame |
| ENST00000332707 | 64833023 | 64833095 | In-frame |
| ENST00000332707 | 64838854 | 64838911 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000332707 | 64811825 | 64811895 | Frame-shift |
| ENST00000332707 | 64828573 | 64828689 | Frame-shift |
| ENST00000332707 | 64815014 | 64815251 | In-frame |
| ENST00000332707 | 64816784 | 64816823 | In-frame |
| ENST00000332707 | 64819117 | 64819237 | In-frame |
| ENST00000332707 | 64833023 | 64833095 | In-frame |
| ENST00000332707 | 64838854 | 64838911 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for XPOT |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000332707 | 6431 | 962 | 64815014 | 64815251 | 1373 | 1609 | 281 | 360 |
| ENST00000332707 | 6431 | 962 | 64816784 | 64816823 | 1610 | 1648 | 360 | 373 |
| ENST00000332707 | 6431 | 962 | 64819117 | 64819237 | 1982 | 2101 | 484 | 524 |
| ENST00000332707 | 6431 | 962 | 64833023 | 64833095 | 3263 | 3334 | 911 | 935 |
| ENST00000332707 | 6431 | 962 | 64838854 | 64838911 | 3335 | 3391 | 935 | 954 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000332707 | 6431 | 962 | 64815014 | 64815251 | 1373 | 1609 | 281 | 360 |
| ENST00000332707 | 6431 | 962 | 64816784 | 64816823 | 1610 | 1648 | 360 | 373 |
| ENST00000332707 | 6431 | 962 | 64819117 | 64819237 | 1982 | 2101 | 484 | 524 |
| ENST00000332707 | 6431 | 962 | 64833023 | 64833095 | 3263 | 3334 | 911 | 935 |
| ENST00000332707 | 6431 | 962 | 64838854 | 64838911 | 3335 | 3391 | 935 | 954 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| O43592 | 281 | 360 | 1 | 962 | Chain | ID=PRO_0000204716;Note=Exportin-T |
| O43592 | 281 | 360 | 1 | 385 | Region | Note=Necessary for interaction with Ran%2C nuclear localization and nuclear import |
| O43592 | 281 | 360 | 360 | 360 | Sequence conflict | Note=Q->R;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| O43592 | 360 | 373 | 1 | 962 | Chain | ID=PRO_0000204716;Note=Exportin-T |
| O43592 | 360 | 373 | 1 | 385 | Region | Note=Necessary for interaction with Ran%2C nuclear localization and nuclear import |
| O43592 | 360 | 373 | 360 | 360 | Sequence conflict | Note=Q->R;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| O43592 | 484 | 524 | 1 | 962 | Chain | ID=PRO_0000204716;Note=Exportin-T |
| O43592 | 484 | 524 | 443 | 962 | Region | Note=Necessary for tRNA-binding%2C cytoplasmic localization and nuclear export |
| O43592 | 911 | 935 | 1 | 962 | Chain | ID=PRO_0000204716;Note=Exportin-T |
| O43592 | 911 | 935 | 443 | 962 | Region | Note=Necessary for tRNA-binding%2C cytoplasmic localization and nuclear export |
| O43592 | 935 | 954 | 1 | 962 | Chain | ID=PRO_0000204716;Note=Exportin-T |
| O43592 | 935 | 954 | 443 | 962 | Region | Note=Necessary for tRNA-binding%2C cytoplasmic localization and nuclear export |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| O43592 | 281 | 360 | 1 | 962 | Chain | ID=PRO_0000204716;Note=Exportin-T |
| O43592 | 281 | 360 | 1 | 385 | Region | Note=Necessary for interaction with Ran%2C nuclear localization and nuclear import |
| O43592 | 281 | 360 | 360 | 360 | Sequence conflict | Note=Q->R;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| O43592 | 360 | 373 | 1 | 962 | Chain | ID=PRO_0000204716;Note=Exportin-T |
| O43592 | 360 | 373 | 1 | 385 | Region | Note=Necessary for interaction with Ran%2C nuclear localization and nuclear import |
| O43592 | 360 | 373 | 360 | 360 | Sequence conflict | Note=Q->R;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| O43592 | 484 | 524 | 1 | 962 | Chain | ID=PRO_0000204716;Note=Exportin-T |
| O43592 | 484 | 524 | 443 | 962 | Region | Note=Necessary for tRNA-binding%2C cytoplasmic localization and nuclear export |
| O43592 | 911 | 935 | 1 | 962 | Chain | ID=PRO_0000204716;Note=Exportin-T |
| O43592 | 911 | 935 | 443 | 962 | Region | Note=Necessary for tRNA-binding%2C cytoplasmic localization and nuclear export |
| O43592 | 935 | 954 | 1 | 962 | Chain | ID=PRO_0000204716;Note=Exportin-T |
| O43592 | 935 | 954 | 443 | 962 | Region | Note=Necessary for tRNA-binding%2C cytoplasmic localization and nuclear export |
Top |
SNVs in the skipped exons for XPOT |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_84934 | 64815015 | 64815251 | 64815219 | 64815219 | Frame_Shift_Del | T | - | p.F350fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_84934 | 64815015 | 64815251 | 64815219 | 64815219 | Frame_Shift_Del | T | - | p.F350fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_84939 | 64816785 | 64816823 | 64816807 | 64816807 | Frame_Shift_Del | A | - | p.Q368fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_84941 | 64819118 | 64819237 | 64819199 | 64819199 | Frame_Shift_Del | T | - | p.F513fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_84944 | 64828574 | 64828689 | 64828605 | 64828605 | Frame_Shift_Del | T | - | p.D867fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_84944 | 64828574 | 64828689 | 64828610 | 64828610 | Frame_Shift_Del | T | - | p.V869fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_84944 | 64828574 | 64828689 | 64828679 | 64828679 | Frame_Shift_Del | A | - | p.Q892fs |
| CESC | TCGA-C5-A1MH-01 | exon_skip_84929 | 64811826 | 64811895 | 64811848 | 64811848 | Nonsense_Mutation | C | T | p.Q75* |
| ESCA | TCGA-L5-A8NS-01 | exon_skip_84929 | 64811826 | 64811895 | 64811879 | 64811879 | Nonsense_Mutation | C | G | p.S85* |
| ESCA | TCGA-L5-A8NS-01 | exon_skip_84929 | 64811826 | 64811895 | 64811879 | 64811879 | Nonsense_Mutation | C | G | p.S85X |
| SKCM | TCGA-D3-A3C1-06 | exon_skip_84934 | 64815015 | 64815251 | 64815126 | 64815126 | Nonsense_Mutation | C | T | p.Q319* |
| SKCM | TCGA-D3-A3C1-06 | exon_skip_84934 | 64815015 | 64815251 | 64815126 | 64815126 | Nonsense_Mutation | C | T | p.Q319X |
| BLCA | TCGA-UY-A9PD-01 | exon_skip_84948 | 64833024 | 64833095 | 64833039 | 64833039 | Nonsense_Mutation | C | T | p.Q917* |
| SKCM | TCGA-DA-A1HY-06 | exon_skip_84948 | 64833024 | 64833095 | 64833072 | 64833072 | Nonsense_Mutation | C | T | p.Q928* |
| UCEC | TCGA-AP-A05N-01 | exon_skip_84952 | 64838855 | 64838911 | 64838864 | 64838864 | Nonsense_Mutation | C | T | p.Q939* |
| UCEC | TCGA-BG-A0M8-01 | exon_skip_84929 | 64811826 | 64811895 | 64811794 | 64811824 | Splice_Site | CCATTATTCTTTTTCTTCTCTATTTTGAACA | - | p.K67_splice |
| UCEC | TCGA-D1-A0ZO-01 | exon_skip_84948 | 64833024 | 64833095 | 64833096 | 64833096 | Splice_Site | G | A | p.Q935_splice |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| CL34_LARGE_INTESTINE | 64811826 | 64811895 | 64811864 | 64811864 | Missense_Mutation | G | T | p.R80M |
| AU565_BREAST | 64815015 | 64815251 | 64815114 | 64815114 | Missense_Mutation | A | G | p.I315V |
| SKBR3_BREAST | 64815015 | 64815251 | 64815114 | 64815114 | Missense_Mutation | A | G | p.I315V |
| MDAMB453_BREAST | 64815015 | 64815251 | 64815147 | 64815147 | Missense_Mutation | G | C | p.E326Q |
| HEC108_ENDOMETRIUM | 64828574 | 64828689 | 64828616 | 64828616 | Missense_Mutation | A | G | p.K871R |
| NCIH596_LUNG | 64833024 | 64833095 | 64833030 | 64833030 | Missense_Mutation | G | A | p.E914K |
| NCIH1770_LUNG | 64815015 | 64815251 | 64815126 | 64815126 | Nonsense_Mutation | C | T | p.Q319* |
| NCIH2106_LUNG | 64815015 | 64815251 | 64815126 | 64815126 | Nonsense_Mutation | C | T | p.Q319* |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for XPOT |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for XPOT |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for XPOT |
Top |
RelatedDrugs for XPOT |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for XPOT |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|