|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for WDR6 |
 Gene summary |
| Gene information | Gene symbol | WDR6 | Gene ID | 11180 |
| Gene name | WD repeat domain 6 | |
| Synonyms | - | |
| Cytomap | 3p21.31 | |
| Type of gene | protein-coding | |
| Description | WD repeat-containing protein 6 | |
| Modification date | 20180519 | |
| UniProtAcc | Q9NNW5 | |
| Context | PubMed: WDR6 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| WDR6 | GO:0007050 | cell cycle arrest | 17216128 |
| WDR6 | GO:0008285 | negative regulation of cell proliferation | 17216128 |
Top |
Exon skipping events across known transcript of Ensembl for WDR6 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for WDR6 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for WDR6 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_374127 | 3 | 49044835:49044964:49046341:49046457:49049067:49049148 | 49046341:49046457 | ENSG00000178252.13 | ENST00000462064.1 |
| exon_skip_374129 | 3 | 49044835:49044964:49046359:49046457:49048853:49048949 | 49046359:49046457 | ENSG00000178252.13 | ENST00000429900.2 |
| exon_skip_374130 | 3 | 49044835:49044964:49046359:49046457:49049067:49049148 | 49046359:49046457 | ENSG00000178252.13 | ENST00000420783.3,ENST00000473238.2 |
| exon_skip_374131 | 3 | 49044835:49044964:49046359:49046457:49049454:49049678 | 49046359:49046457 | ENSG00000178252.13 | ENST00000488572.2 |
| exon_skip_374133 | 3 | 49044835:49044964:49048853:49048949:49049067:49049148 | 49048853:49048949 | ENSG00000178252.13 | ENST00000438660.1 |
| exon_skip_374138 | 3 | 49044835:49044964:49048853:49051549:49051642:49051726 | 49048853:49051549 | ENSG00000178252.13 | ENST00000452875.1 |
| exon_skip_374143 | 3 | 49044835:49044964:49049067:49051549:49051642:49051726 | 49049067:49051549 | ENSG00000178252.13 | ENST00000608424.1 |
| exon_skip_374149 | 3 | 49044835:49044964:49050723:49051549:49051642:49051726 | 49050723:49051549 | ENSG00000178252.13 | ENST00000415265.2 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for WDR6 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_374127 | 3 | 49044835:49044964:49046341:49046457:49049067:49049148 | 49046341:49046457 | ENSG00000178252.13 | ENST00000462064.1 |
| exon_skip_374129 | 3 | 49044835:49044964:49046359:49046457:49048853:49048949 | 49046359:49046457 | ENSG00000178252.13 | ENST00000429900.2 |
| exon_skip_374130 | 3 | 49044835:49044964:49046359:49046457:49049067:49049148 | 49046359:49046457 | ENSG00000178252.13 | ENST00000473238.2,ENST00000420783.3 |
| exon_skip_374131 | 3 | 49044835:49044964:49046359:49046457:49049454:49049678 | 49046359:49046457 | ENSG00000178252.13 | ENST00000488572.2 |
| exon_skip_374133 | 3 | 49044835:49044964:49048853:49048949:49049067:49049148 | 49048853:49048949 | ENSG00000178252.13 | ENST00000438660.1 |
| exon_skip_374138 | 3 | 49044835:49044964:49048853:49051549:49051642:49051726 | 49048853:49051549 | ENSG00000178252.13 | ENST00000452875.1 |
| exon_skip_374143 | 3 | 49044835:49044964:49049067:49051549:49051642:49051726 | 49049067:49051549 | ENSG00000178252.13 | ENST00000608424.1 |
| exon_skip_374149 | 3 | 49044835:49044964:49050723:49051549:49051642:49051726 | 49050723:49051549 | ENSG00000178252.13 | ENST00000415265.2 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for WDR6 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000608424 | 49049067 | 49051549 | Frame-shift |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000608424 | 49049067 | 49051549 | Frame-shift |
Top |
Infer the effects of exon skipping event on protein functional features for WDR6 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
Top |
SNVs in the skipped exons for WDR6 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| KICH | TCGA-KO-8408-01 | exon_skip_374138 | 49048854 | 49051549 | 49049218 | 49049218 | Frame_Shift_Del | T | - | p.V114fs |
| KICH | TCGA-KO-8408-01 | exon_skip_374143 | 49049068 | 49051549 | 49049218 | 49049218 | Frame_Shift_Del | T | - | p.V114fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_374138 | 49048854 | 49051549 | 49049707 | 49049707 | Frame_Shift_Del | G | - | p.R277fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_374143 | 49049068 | 49051549 | 49049707 | 49049707 | Frame_Shift_Del | G | - | p.R277fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_374138 | 49048854 | 49051549 | 49049884 | 49049884 | Frame_Shift_Del | C | - | p.A336fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_374143 | 49049068 | 49051549 | 49049884 | 49049884 | Frame_Shift_Del | C | - | p.A336fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_374138 | 49048854 | 49051549 | 49049902 | 49049902 | Frame_Shift_Del | G | - | p.W342fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_374143 | 49049068 | 49051549 | 49049902 | 49049902 | Frame_Shift_Del | G | - | p.W342fs |
| BRCA | TCGA-B6-A0RS-01 | exon_skip_374138 | 49048854 | 49051549 | 49050218 | 49050246 | Frame_Shift_Del | CAAGGTTGTCCCCATCAACACTCCAACTG | - | p.K448fs |
| BRCA | TCGA-B6-A0RS-01 | exon_skip_374143 | 49049068 | 49051549 | 49050218 | 49050246 | Frame_Shift_Del | CAAGGTTGTCCCCATCAACACTCCAACTG | - | p.K448fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_374138 | 49048854 | 49051549 | 49050468 | 49050468 | Frame_Shift_Del | C | - | p.P532fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_374143 | 49049068 | 49051549 | 49050468 | 49050468 | Frame_Shift_Del | C | - | p.P532fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_374138 | 49048854 | 49051549 | 49050519 | 49050519 | Frame_Shift_Del | T | - | p.F548fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_374143 | 49049068 | 49051549 | 49050519 | 49050519 | Frame_Shift_Del | T | - | p.F548fs |
| SKCM | TCGA-GN-A8LK-06 | exon_skip_374138 | 49048854 | 49051549 | 49050660 | 49050660 | Frame_Shift_Del | T | - | p.S595fs |
| SKCM | TCGA-GN-A8LK-06 | exon_skip_374143 | 49049068 | 49051549 | 49050660 | 49050660 | Frame_Shift_Del | T | - | p.S595fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_374138 | 49048854 | 49051549 | 49051048 | 49051048 | Frame_Shift_Del | T | - | p.I724fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_374143 | 49049068 | 49051549 | 49051048 | 49051048 | Frame_Shift_Del | T | - | p.I724fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_374149 | 49050724 | 49051549 | 49051048 | 49051048 | Frame_Shift_Del | T | - | p.I724fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_374138 | 49048854 | 49051549 | 49051112 | 49051112 | Frame_Shift_Del | G | - | p.L745fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_374143 | 49049068 | 49051549 | 49051112 | 49051112 | Frame_Shift_Del | G | - | p.L745fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_374149 | 49050724 | 49051549 | 49051112 | 49051112 | Frame_Shift_Del | G | - | p.L745fs |
| COAD | TCGA-D5-6540-01 | exon_skip_374138 | 49048854 | 49051549 | 49051382 | 49051382 | Frame_Shift_Del | G | - | p.A835fs |
| COAD | TCGA-D5-6540-01 | exon_skip_374143 | 49049068 | 49051549 | 49051382 | 49051382 | Frame_Shift_Del | G | - | p.A835fs |
| COAD | TCGA-D5-6540-01 | exon_skip_374149 | 49050724 | 49051549 | 49051382 | 49051382 | Frame_Shift_Del | G | - | p.A835fs |
| LUAD | TCGA-17-Z053-01 | exon_skip_374138 | 49048854 | 49051549 | 49049577 | 49049578 | Frame_Shift_Ins | - | G | p.N234fs |
| LUAD | TCGA-17-Z053-01 | exon_skip_374143 | 49049068 | 49051549 | 49049577 | 49049578 | Frame_Shift_Ins | - | G | p.N234fs |
| KIRC | TCGA-AK-3444-01 | exon_skip_374138 | 49048854 | 49051549 | 49051381 | 49051382 | Frame_Shift_Ins | - | G | p.G835fs |
| KIRC | TCGA-AK-3444-01 | exon_skip_374143 | 49049068 | 49051549 | 49051381 | 49051382 | Frame_Shift_Ins | - | G | p.G835fs |
| KIRC | TCGA-AK-3444-01 | exon_skip_374149 | 49050724 | 49051549 | 49051381 | 49051382 | Frame_Shift_Ins | - | G | p.G835fs |
| UCEC | TCGA-BS-A0UV-01 | exon_skip_374138 | 49048854 | 49051549 | 49050798 | 49050798 | Nonsense_Mutation | C | T | p.R641* |
| UCEC | TCGA-BS-A0UV-01 | exon_skip_374143 | 49049068 | 49051549 | 49050798 | 49050798 | Nonsense_Mutation | C | T | p.R641* |
| UCEC | TCGA-BS-A0UV-01 | exon_skip_374149 | 49050724 | 49051549 | 49050798 | 49050798 | Nonsense_Mutation | C | T | p.R641* |
| LUAD | TCGA-55-7283-01 | exon_skip_374138 | 49048854 | 49051549 | 49051255 | 49051255 | Nonsense_Mutation | C | G | p.S793* |
| LUAD | TCGA-55-7283-01 | exon_skip_374143 | 49049068 | 49051549 | 49051255 | 49051255 | Nonsense_Mutation | C | G | p.S793* |
| LUAD | TCGA-55-7283-01 | exon_skip_374149 | 49050724 | 49051549 | 49051255 | 49051255 | Nonsense_Mutation | C | G | p.S793* |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| SUIT2_PANCREAS | 49048854 | 49051549 | 49049104 | 49049104 | Missense_Mutation | T | C | p.F46S |
| SUIT2_PANCREAS | 49049068 | 49051549 | 49049104 | 49049104 | Missense_Mutation | T | C | p.F46S |
| SW1271_LUNG | 49048854 | 49051549 | 49049191 | 49049191 | Missense_Mutation | A | T | p.N75I |
| SW1271_LUNG | 49049068 | 49051549 | 49049191 | 49049191 | Missense_Mutation | A | T | p.N75I |
| HEC265_ENDOMETRIUM | 49048854 | 49051549 | 49049401 | 49049401 | Missense_Mutation | T | C | p.V145A |
| HEC265_ENDOMETRIUM | 49049068 | 49051549 | 49049401 | 49049401 | Missense_Mutation | T | C | p.V145A |
| SKMEL5_SKIN | 49048854 | 49051549 | 49049449 | 49049449 | Missense_Mutation | C | T | p.S161F |
| SKMEL5_SKIN | 49049068 | 49051549 | 49049449 | 49049449 | Missense_Mutation | C | T | p.S161F |
| SKMEL5_SKIN | 49048854 | 49051549 | 49049449 | 49049450 | Missense_Mutation | CT | TA | p.S161L |
| SKMEL5_SKIN | 49049068 | 49051549 | 49049449 | 49049450 | Missense_Mutation | CT | TA | p.S161L |
| L33_PANCREAS | 49048854 | 49051549 | 49049551 | 49049551 | Missense_Mutation | A | C | p.D195A |
| L33_PANCREAS | 49049068 | 49051549 | 49049551 | 49049551 | Missense_Mutation | A | C | p.D195A |
| SNU1040_LARGE_INTESTINE | 49048854 | 49051549 | 49049592 | 49049592 | Missense_Mutation | G | A | p.V209M |
| SNU1040_LARGE_INTESTINE | 49049068 | 49051549 | 49049592 | 49049592 | Missense_Mutation | G | A | p.V209M |
| NCIH2286_LUNG | 49048854 | 49051549 | 49049746 | 49049746 | Missense_Mutation | G | A | p.R260H |
| NCIH2286_LUNG | 49049068 | 49051549 | 49049746 | 49049746 | Missense_Mutation | G | A | p.R260H |
| JURKAT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 49048854 | 49051549 | 49049788 | 49049788 | Missense_Mutation | C | T | p.A274V |
| JURKAT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 49049068 | 49051549 | 49049788 | 49049788 | Missense_Mutation | C | T | p.A274V |
| SKUT1_SOFT_TISSUE | 49048854 | 49051549 | 49049847 | 49049847 | Missense_Mutation | C | T | p.R294W |
| SKUT1_SOFT_TISSUE | 49049068 | 49051549 | 49049847 | 49049847 | Missense_Mutation | C | T | p.R294W |
| EFE184_ENDOMETRIUM | 49048854 | 49051549 | 49049862 | 49049862 | Missense_Mutation | C | T | p.R299C |
| EFE184_ENDOMETRIUM | 49049068 | 49051549 | 49049862 | 49049862 | Missense_Mutation | C | T | p.R299C |
| RPMI6666_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 49048854 | 49051549 | 49049863 | 49049863 | Missense_Mutation | G | A | p.R299H |
| RPMI6666_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 49049068 | 49051549 | 49049863 | 49049863 | Missense_Mutation | G | A | p.R299H |
| SLVL_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 49048854 | 49051549 | 49050060 | 49050060 | Missense_Mutation | G | A | p.V365M |
| SLVL_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 49049068 | 49051549 | 49050060 | 49050060 | Missense_Mutation | G | A | p.V365M |
| LNCAPCLONEFGC_PROSTATE | 49048854 | 49051549 | 49050403 | 49050403 | Missense_Mutation | A | T | p.K479M |
| LNCAPCLONEFGC_PROSTATE | 49049068 | 49051549 | 49050403 | 49050403 | Missense_Mutation | A | T | p.K479M |
| TMK1_STOMACH | 49048854 | 49051549 | 49050414 | 49050414 | Missense_Mutation | C | T | p.R483W |
| TMK1_STOMACH | 49049068 | 49051549 | 49050414 | 49050414 | Missense_Mutation | C | T | p.R483W |
| OVCAR4_OVARY | 49048854 | 49051549 | 49050472 | 49050472 | Missense_Mutation | C | A | p.P502Q |
| OVCAR4_OVARY | 49049068 | 49051549 | 49050472 | 49050472 | Missense_Mutation | C | A | p.P502Q |
| AU565_BREAST | 49048854 | 49051549 | 49050667 | 49050667 | Missense_Mutation | A | T | p.H567L |
| AU565_BREAST | 49049068 | 49051549 | 49050667 | 49050667 | Missense_Mutation | A | T | p.H567L |
| SKBR3_BREAST | 49048854 | 49051549 | 49050667 | 49050667 | Missense_Mutation | A | T | p.H567L |
| SKBR3_BREAST | 49049068 | 49051549 | 49050667 | 49050667 | Missense_Mutation | A | T | p.H567L |
| HCT15_LARGE_INTESTINE | 49048854 | 49051549 | 49050741 | 49050741 | Missense_Mutation | T | C | p.Y592H |
| HCT15_LARGE_INTESTINE | 49050724 | 49051549 | 49050741 | 49050741 | Missense_Mutation | T | C | p.Y592H |
| HCT15_LARGE_INTESTINE | 49049068 | 49051549 | 49050741 | 49050741 | Missense_Mutation | T | C | p.Y592H |
| RL952_ENDOMETRIUM | 49048854 | 49051549 | 49050837 | 49050837 | Missense_Mutation | G | A | p.D624N |
| RL952_ENDOMETRIUM | 49050724 | 49051549 | 49050837 | 49050837 | Missense_Mutation | G | A | p.D624N |
| RL952_ENDOMETRIUM | 49049068 | 49051549 | 49050837 | 49050837 | Missense_Mutation | G | A | p.D624N |
| HEPG2_LIVER | 49048854 | 49051549 | 49050922 | 49050922 | Missense_Mutation | A | G | p.N652S |
| HEPG2_LIVER | 49050724 | 49051549 | 49050922 | 49050922 | Missense_Mutation | A | G | p.N652S |
| HEPG2_LIVER | 49049068 | 49051549 | 49050922 | 49050922 | Missense_Mutation | A | G | p.N652S |
| C3A_LIVER | 49048854 | 49051549 | 49050922 | 49050922 | Missense_Mutation | A | G | p.N652S |
| C3A_LIVER | 49050724 | 49051549 | 49050922 | 49050922 | Missense_Mutation | A | G | p.N652S |
| C3A_LIVER | 49049068 | 49051549 | 49050922 | 49050922 | Missense_Mutation | A | G | p.N652S |
| TE6_OESOPHAGUS | 49048854 | 49051549 | 49051084 | 49051084 | Missense_Mutation | G | T | p.C706F |
| TE6_OESOPHAGUS | 49050724 | 49051549 | 49051084 | 49051084 | Missense_Mutation | G | T | p.C706F |
| TE6_OESOPHAGUS | 49049068 | 49051549 | 49051084 | 49051084 | Missense_Mutation | G | T | p.C706F |
| MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 49048854 | 49051549 | 49051092 | 49051092 | Missense_Mutation | C | T | p.R709C |
| MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 49050724 | 49051549 | 49051092 | 49051092 | Missense_Mutation | C | T | p.R709C |
| MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 49049068 | 49051549 | 49051092 | 49051092 | Missense_Mutation | C | T | p.R709C |
| D245MG_CENTRAL_NERVOUS_SYSTEM | 49048854 | 49051549 | 49051179 | 49051179 | Missense_Mutation | G | A | p.D738N |
| D245MG_CENTRAL_NERVOUS_SYSTEM | 49050724 | 49051549 | 49051179 | 49051179 | Missense_Mutation | G | A | p.D738N |
| D245MG_CENTRAL_NERVOUS_SYSTEM | 49049068 | 49051549 | 49051179 | 49051179 | Missense_Mutation | G | A | p.D738N |
| JURKAT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 49048854 | 49051549 | 49051204 | 49051204 | Missense_Mutation | G | A | p.C746Y |
| JURKAT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 49050724 | 49051549 | 49051204 | 49051204 | Missense_Mutation | G | A | p.C746Y |
| JURKAT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 49049068 | 49051549 | 49051204 | 49051204 | Missense_Mutation | G | A | p.C746Y |
| TK_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 49048854 | 49051549 | 49051243 | 49051243 | Missense_Mutation | C | T | p.T759I |
| TK_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 49050724 | 49051549 | 49051243 | 49051243 | Missense_Mutation | C | T | p.T759I |
| TK_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 49049068 | 49051549 | 49051243 | 49051243 | Missense_Mutation | C | T | p.T759I |
| SNU626_CENTRAL_NERVOUS_SYSTEM | 49048854 | 49051549 | 49051285 | 49051285 | Missense_Mutation | A | G | p.H773R |
| SNU626_CENTRAL_NERVOUS_SYSTEM | 49050724 | 49051549 | 49051285 | 49051285 | Missense_Mutation | A | G | p.H773R |
| SNU626_CENTRAL_NERVOUS_SYSTEM | 49049068 | 49051549 | 49051285 | 49051285 | Missense_Mutation | A | G | p.H773R |
| CL34_LARGE_INTESTINE | 49048854 | 49051549 | 49051299 | 49051299 | Missense_Mutation | C | T | p.R778C |
| CL34_LARGE_INTESTINE | 49050724 | 49051549 | 49051299 | 49051299 | Missense_Mutation | C | T | p.R778C |
| CL34_LARGE_INTESTINE | 49049068 | 49051549 | 49051299 | 49051299 | Missense_Mutation | C | T | p.R778C |
| CL34_LARGE_INTESTINE | 49048854 | 49051549 | 49051360 | 49051360 | Missense_Mutation | T | C | p.L798P |
| CL34_LARGE_INTESTINE | 49050724 | 49051549 | 49051360 | 49051360 | Missense_Mutation | T | C | p.L798P |
| CL34_LARGE_INTESTINE | 49049068 | 49051549 | 49051360 | 49051360 | Missense_Mutation | T | C | p.L798P |
| COLO678_LARGE_INTESTINE | 49048854 | 49051549 | 49051423 | 49051423 | Missense_Mutation | C | A | p.T819N |
| COLO678_LARGE_INTESTINE | 49050724 | 49051549 | 49051423 | 49051423 | Missense_Mutation | C | A | p.T819N |
| COLO678_LARGE_INTESTINE | 49049068 | 49051549 | 49051423 | 49051423 | Missense_Mutation | C | A | p.T819N |
| LS123_LARGE_INTESTINE | 49048854 | 49051549 | 49051423 | 49051423 | Missense_Mutation | C | A | p.T819N |
| LS123_LARGE_INTESTINE | 49050724 | 49051549 | 49051423 | 49051423 | Missense_Mutation | C | A | p.T819N |
| LS123_LARGE_INTESTINE | 49049068 | 49051549 | 49051423 | 49051423 | Missense_Mutation | C | A | p.T819N |
| KMRC20_KIDNEY | 49048854 | 49051549 | 49051510 | 49051510 | Missense_Mutation | G | A | p.R848H |
| KMRC20_KIDNEY | 49050724 | 49051549 | 49051510 | 49051510 | Missense_Mutation | G | A | p.R848H |
| KMRC20_KIDNEY | 49049068 | 49051549 | 49051510 | 49051510 | Missense_Mutation | G | A | p.R848H |
| MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 49048854 | 49051549 | 49051540 | 49051540 | Missense_Mutation | C | G | p.P858R |
| MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 49050724 | 49051549 | 49051540 | 49051540 | Missense_Mutation | C | G | p.P858R |
| MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 49049068 | 49051549 | 49051540 | 49051540 | Missense_Mutation | C | G | p.P858R |
| DSH1_URINARY_TRACT | 49048854 | 49051549 | 49049244 | 49049244 | Nonsense_Mutation | C | T | p.R93* |
| DSH1_URINARY_TRACT | 49049068 | 49051549 | 49049244 | 49049244 | Nonsense_Mutation | C | T | p.R93* |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for WDR6 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for WDR6 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for WDR6 |
Top |
RelatedDrugs for WDR6 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for WDR6 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|