|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for CDH8 |
 Gene summary |
| Gene information | Gene symbol | CDH8 | Gene ID | 1006 |
| Gene name | cadherin 8 | |
| Synonyms | Nbla04261 | |
| Cytomap | 16q21 | |
| Type of gene | protein-coding | |
| Description | cadherin-8cadherin 8, type 2 | |
| Modification date | 20180523 | |
| UniProtAcc | P55286 | |
| Context | PubMed: CDH8 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for CDH8 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for CDH8 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for CDH8 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_145012 | 16 | 61747744:61747862:61760997:61761119:61823249:61823386 | 61760997:61761119 | ENSG00000150394.9 | ENST00000299345.6,ENST00000577390.1,ENST00000577730.1 |
| exon_skip_145013 | 16 | 61760997:61761119:61823249:61823386:61851382:61851636 | 61823249:61823386 | ENSG00000150394.9 | ENST00000299345.6,ENST00000577390.1,ENST00000577730.1,ENST00000584337.1 |
| exon_skip_145014 | 16 | 61854829:61855017:61858915:61859083:61891022:61891142 | 61858915:61859083 | ENSG00000150394.9 | ENST00000299345.6,ENST00000577390.1,ENST00000583382.1,ENST00000577730.1,ENST00000585315.1,ENST00000584337.1 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for CDH8 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_145012 | 16 | 61747744:61747862:61760997:61761119:61823249:61823386 | 61760997:61761119 | ENSG00000150394.9 | ENST00000577730.1,ENST00000577390.1,ENST00000299345.6 |
| exon_skip_145013 | 16 | 61760997:61761119:61823249:61823386:61851382:61851636 | 61823249:61823386 | ENSG00000150394.9 | ENST00000577730.1,ENST00000577390.1,ENST00000299345.6,ENST00000584337.1 |
| exon_skip_145014 | 16 | 61854829:61855017:61858915:61859083:61891022:61891142 | 61858915:61859083 | ENSG00000150394.9 | ENST00000577730.1,ENST00000585315.1,ENST00000577390.1,ENST00000299345.6,ENST00000584337.1,ENST00000583382.1 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for CDH8 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000577390 | 61760997 | 61761119 | Frame-shift |
| ENST00000577390 | 61823249 | 61823386 | Frame-shift |
| ENST00000577390 | 61858915 | 61859083 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000577390 | 61760997 | 61761119 | Frame-shift |
| ENST00000577390 | 61823249 | 61823386 | Frame-shift |
| ENST00000577390 | 61858915 | 61859083 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for CDH8 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000577390 | 9738 | 799 | 61858915 | 61859083 | 1623 | 1790 | 222 | 278 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000577390 | 9738 | 799 | 61858915 | 61859083 | 1623 | 1790 | 222 | 278 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| P55286 | 222 | 278 | 62 | 799 | Chain | ID=PRO_0000003774;Note=Cadherin-8 |
| P55286 | 222 | 278 | 168 | 276 | Domain | Note=Cadherin 2;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00043 |
| P55286 | 222 | 278 | 277 | 391 | Domain | Note=Cadherin 3;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00043 |
| P55286 | 222 | 278 | 62 | 621 | Topological domain | Note=Extracellular;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| P55286 | 222 | 278 | 62 | 799 | Chain | ID=PRO_0000003774;Note=Cadherin-8 |
| P55286 | 222 | 278 | 168 | 276 | Domain | Note=Cadherin 2;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00043 |
| P55286 | 222 | 278 | 277 | 391 | Domain | Note=Cadherin 3;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00043 |
| P55286 | 222 | 278 | 62 | 621 | Topological domain | Note=Extracellular;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
Top |
SNVs in the skipped exons for CDH8 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_145012 | 61760998 | 61761119 | 61761007 | 61761007 | Frame_Shift_Del | T | - | p.K509fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_145012 | 61760998 | 61761119 | 61761014 | 61761014 | Frame_Shift_Del | T | - | p.N507fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_145013 | 61823250 | 61823386 | 61823382 | 61823382 | Frame_Shift_Del | A | - | p.S428fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_145014 | 61858916 | 61859083 | 61858926 | 61858926 | Frame_Shift_Del | T | - | p.K275fs |
| BLCA | TCGA-2F-A9KO-01 | exon_skip_145012 | 61760998 | 61761119 | 61761012 | 61761012 | Nonsense_Mutation | C | A | p.G508* |
| READ | TCGA-F5-6814-01 | exon_skip_145012 | 61760998 | 61761119 | 61761051 | 61761051 | Nonsense_Mutation | C | A | p.E495X |
| LUAD | TCGA-38-4631-01 | exon_skip_145013 | 61823250 | 61823386 | 61823358 | 61823358 | Nonsense_Mutation | C | A | p.E436* |
| LUSC | TCGA-34-2608-01 | exon_skip_145014 | 61858916 | 61859083 | 61858915 | 61858915 | Splice_Site | C | T | p.S279_splice |
| UCEC | TCGA-AP-A059-01 | exon_skip_145014 | 61858916 | 61859083 | 61858915 | 61858915 | Splice_Site | C | A | e4+1 |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| KMS11_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 61760998 | 61761119 | 61761061 | 61761086 | Frame_Shift_Del | GTCATTGACATCCAGCACTTTAATAG | - | p.AIKVLDVND483fs |
| IPC298_SKIN | 61760998 | 61761119 | 61761012 | 61761012 | Missense_Mutation | C | T | p.G508R |
| JHUEM7_ENDOMETRIUM | 61760998 | 61761119 | 61761024 | 61761024 | Missense_Mutation | A | C | p.L504V |
| KMH2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 61760998 | 61761119 | 61761081 | 61761081 | Missense_Mutation | T | G | p.K485Q |
| DND41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 61760998 | 61761119 | 61761086 | 61761086 | Missense_Mutation | G | T | p.A483D |
| NCIH630_LARGE_INTESTINE | 61760998 | 61761119 | 61761086 | 61761086 | Missense_Mutation | G | A | p.A483V |
| KARPAS1106P_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 61760998 | 61761119 | 61761089 | 61761089 | Missense_Mutation | A | G | p.V482A |
| KP1N_PANCREAS | 61760998 | 61761119 | 61761107 | 61761107 | Missense_Mutation | T | C | p.Q476R |
| LC1F_LUNG | 61760998 | 61761119 | 61761115 | 61761115 | Missense_Mutation | G | T | p.N473K |
| LC1SQSF_LUNG | 61760998 | 61761119 | 61761115 | 61761115 | Missense_Mutation | G | T | p.N473K |
| LC1SQ_LUNG | 61760998 | 61761119 | 61761115 | 61761115 | Missense_Mutation | G | T | p.N473K |
| DU145_PROSTATE | 61823250 | 61823386 | 61823306 | 61823306 | Missense_Mutation | G | A | p.P453L |
| DOTC24510_CERVIX | 61823250 | 61823386 | 61823313 | 61823313 | Missense_Mutation | C | G | p.A451P |
| BV173_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 61823250 | 61823386 | 61823318 | 61823318 | Missense_Mutation | G | A | p.T449M |
| LOVO_LARGE_INTESTINE | 61823250 | 61823386 | 61823342 | 61823342 | Missense_Mutation | A | G | p.I441T |
| NCIH2172_LUNG | 61823250 | 61823386 | 61823347 | 61823347 | Missense_Mutation | G | T | p.F439L |
| EVSAT_BREAST | 61823250 | 61823386 | 61823364 | 61823364 | Missense_Mutation | C | A | p.D434Y |
| NCIH526_LUNG | 61823250 | 61823386 | 61823372 | 61823372 | Missense_Mutation | C | T | p.R431Q |
| HCC33_LUNG | 61823250 | 61823386 | 61823373 | 61823373 | Missense_Mutation | G | A | p.R431W |
| NCIH3255_LUNG | 61858916 | 61859083 | 61858922 | 61858922 | Missense_Mutation | C | A | p.A277S |
| VMCUB1_URINARY_TRACT | 61858916 | 61859083 | 61858963 | 61858963 | Missense_Mutation | G | A | p.T263I |
| HEC151_ENDOMETRIUM | 61858916 | 61859083 | 61858987 | 61858987 | Missense_Mutation | C | T | p.G255D |
| OE33_OESOPHAGUS | 61858916 | 61859083 | 61859068 | 61859068 | Missense_Mutation | G | A | p.A228V |
| HEC1A_ENDOMETRIUM | 61858916 | 61859083 | 61859077 | 61859077 | Missense_Mutation | A | T | p.I225K |
| HEC108_ENDOMETRIUM | 61858916 | 61859083 | 61858919 | 61858919 | Nonsense_Mutation | G | A | p.Q278* |
| LNCAPCLONEFGC_PROSTATE | 61858916 | 61859083 | 61858917 | 61858917 | Splice_Site | C | A | p.Q278H |
| IGR1_SKIN | 61858916 | 61859083 | 61858917 | 61858917 | Splice_Site | C | T | p.Q278Q |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for CDH8 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for CDH8 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for CDH8 |
Top |
RelatedDrugs for CDH8 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for CDH8 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| CDH8 | C0001973 | Alcoholic Intoxication, Chronic | 1 | PSYGENET |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|