This database is called CRISPRoffT, and the full name is “CRISPR/Cas Off-Target Integrated Database”. The icon on the left side of the image is the logo of this database, depicting a CRISPR/Cas guide sequence being matched to a DNA sequence and then cutting both DNA strands. The right side of the image shows the database name and full name.

Home

Download & Upload

Statistics

Landscape

Help

Contact

About CRISPRoffT

Here is an schematic overview of this database. This image shows why CRISPR/Cas off-targets exist, where the data came from, what modules are included in this database, and what we have done with this database. The upper part of the image shows that the CRISPR/Cas DNA editing techonolgy produces off-targets due to sequence mismatches. We collected data from PubMed Central. In the middle of the image is CRISPRoffT, the name of the database. Below the database name is a section with 5 bulleted lists. The first list is titled 'Search By', with 4 bullet points: 'Guide Sequence', 'Gene Symbol', 'Target Sequence', and 'Target Region'. The second list is titled 'Browse By', with 3 bullet points: 'Source', 'Technology', 'Cas enzyme and guide RNA combination'. The third list is titled 'Statistics', with 1 bullet points: 'Summary of data'. The fourth list is titled 'Download', with 1 bullet points: 'Table of data'. The fifth list is titled 'Analysis', with 3 bullet points:'Comparison of potential off-target data', 'Comparison of validated off-target data', and 'Summary of each search or browse'.

   CRISPRoffT is a comprehensive database including both predicted and validated CRISPR/Cas off-targets. It provides essential safety information for potential therapeutic CRISPR applications and a wealth of training data for the development of accuracy algorithms. This comprehensive database emcompasses 226,298 potential off-targets for 371 guide-RNA sequences. These sequences were predicted by 29 distinct technologies and manually collected from 74 studies. Among these, 8,940 predicted off-targets have been experimentally validated. The database further includes 85 different Cas/gRNA combinations used in 3 CRISPR systems. It also covers 34 different cell lines, cell types or tissues from Homo sapiens and Mus musculus. All on- and off-targets are filled to complete sequences, including PAM sequences, and are annotated with genomic coordinates and gene names. Our database also conducts comparative analysis under different conditions for each guide sequence, gene, cell type, technology, and Cas/gRNA combination.

   CRISPRoffT characterizes the significant impact guide and Cas enzyme selection on measurable off-target activity. Additionally, the database's unprecedented scope and inclusion of validation data allows it to serve as valuable training data for off-target prediction algorithms and guide RNA design algorithms. Validated off-targets are especially important for this purpose, as experimental methods of off-target prediction yield many sites that cannot be validated. Ultimately, CRISPRoffT provides valuable insights that can enable advancements in safety-driven design of CRISPR-based therapeutics.

bullet pointSearch

E.g. Guide sequence: GAGTCCGAGCAGAAGAAGAAGGG

E.g. Species: Homo sapiens, Gene symbol: FANCF
       Species: Mus musculus, Gene symbol: Pcsk9

E.g. On-target sequence: GGAATCCCTTCTGCAGCACCTGG;
       Off-target sequence: GGAGTCCCTCCTGCAGCACCTGA

E.g. Assembly: hg38, Region: chr11:22625000-22625808
bullet pointBrowse by source

   After selecting a species in the left drop-down column, the right drop-down column will show the cell types under the species that are included in this database. Each entry shows comprehensive information about the technology, on-target, and off-target effects for which the experiment was performed in this cell line, cell type, or tissue.

     
bullet pointBrowse by technology

   After selecting a reaction location in the left drop-down column, the right drop-down column will show the technologies under the reaction location that are included in this database. Each entry shows comprehensive information about the cell line, on-target, and off-target effects for which the experiment was performed using this technology.

     
bullet pointBrowse by Cas enzyme and guide RNA combination

   After selecting a Cas enzyme in the left drop-down column, the right drop-down column will show the guide RNAs under the Cas enzyme that are included in this database. Each entry shows comprehensive information about the technology, cell line, on-target, and off-target effects using this Cas enzyme and guide RNA combination.

   • Cas9: also known as SpCas9, belongs to the Class 2 CRISPR family, extracted from the bacterium Streptococcus pyogenes.
     
   • Cas12a: also known as Cpf1, AsCpf1, AsCas12a, belongs to the Class 2 CRISPR family, extracted from the bacterium Acidaminococcu and Lachnospiraceae.
     
   • Prime Editor: A fusion protein, consisting of a catalytically impaired Cas9 endonuclease (Cas9n) fused to an engineered reverse transcriptase enzyme, and a prime editing guide RNA (pegRNA). Prime editing mediates targeted insertions, deletions, and all possible base-to-base conversions without the need for double strand breaks (DSBs) or donor DNA templates.
     
   • Base Editor: A gene-editing tool with a deaminase enzyme that enables precise single-base substitution in DNA or RNA without generating. There are two types of base editors. The first type, known as cytosine base editors (BE or CBE), can substitute a cytosine base for a thymine (C to T). The second type, called adenine base editors (ABE), are a newer development and are able to introduce adenine-to-guanine (A to G) substitutions.