|
||||||
|
 | |
| |
| Differntial gene expression between RNA A-to-I edited versus non-edited samples |
| |
| |
| The effects of the RNA editing to the stability of the RNA structures |
| |
| |
| |
|
Gene summary for LRRC37A5P |
 Gene summary |
| Gene information | Gene symbol | LRRC37A5P | Gene ID | 652972 |
| Gene name | leucine rich repeat containing 37 member A5, pseudogene | |
| Synonyms | C9orf29 | |
| Cytomap | 9q31.3 | |
| Type of gene | pseudo | |
| Description | - | |
| Modification date | 20200313 | |
| UniProtAcc | Q49AS3, | |
| Context |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
RNA A-to-I events for LRRC37A5P |
| RNA A-to-I editing events in the ROSMAP, MSBB, and Mayo data sets based on Ensembl gene isoform structure. * This pie chart shows the number of RNA A-to-I editing events in different types of transcripts (# event, percentage). |
 |
| RNA editing frequencies across three data sets. |
| The number of RNA A-to-I editing events in different types of transcripts (# event, percentage). |
 |
| RNA A-to-I editing events in AD. |
| ADediting_1431396(111627237, -), ADediting_1431397(111627250, -), ADediting_1431398(111627251, -), ADediting_1431399(111627262, -), ADediting_1431400(111627291, -), ADediting_1431401(111627297, -), ADediting_1431402(111627305, -), ADediting_1431403(111627390, -), ADediting_1431404(111627396, -), ADediting_1431405(111627406, -), |
Top |
RNA editing positional annotations for LRRC37A5P using Annovar |
| Protein coding RNA editing(s). |
| ADeditome ID | Position | Variant type | ENST | NTchange | AAchange | SIFT_score | Polyphen2_HVAR_score | PROVEAN_pred |
| Gene structure information of RNA editing(s). |
| ADeditome ID | Position | Variant type |
| ADediting_1431396 | chr9_111627237_- | ncRNA_intronic |
| ADediting_1431397 | chr9_111627250_- | ncRNA_intronic |
| ADediting_1431398 | chr9_111627251_- | ncRNA_intronic |
| ADediting_1431399 | chr9_111627262_- | ncRNA_intronic |
| ADediting_1431400 | chr9_111627291_- | ncRNA_intronic |
| ADediting_1431401 | chr9_111627297_- | ncRNA_intronic |
| ADediting_1431402 | chr9_111627305_- | ncRNA_intronic |
| ADediting_1431403 | chr9_111627390_- | ncRNA_intronic |
| ADediting_1431404 | chr9_111627396_- | ncRNA_intronic |
| ADediting_1431405 | chr9_111627406_- | ncRNA_intronic |
| Repat-regional RNA editing(s). |
| ADeditome ID | Position | Repeat family | Repeat sub family | Repeat name |
| ADediting_1431396 | chr9_111627237_- | SINE | Alu | Name=AluSx |
| ADediting_1431397 | chr9_111627250_- | SINE | Alu | Name=AluSx |
| ADediting_1431398 | chr9_111627251_- | SINE | Alu | Name=AluSx |
| ADediting_1431399 | chr9_111627262_- | SINE | Alu | Name=AluSx |
| ADediting_1431400 | chr9_111627291_- | SINE | Alu | Name=AluSx |
| ADediting_1431401 | chr9_111627297_- | SINE | Alu | Name=AluSx |
| ADediting_1431402 | chr9_111627305_- | SINE | Alu | Name=AluSx |
| ADediting_1431403 | chr9_111627390_- | SINE | Alu | Name=AluSx |
| ADediting_1431404 | chr9_111627396_- | SINE | Alu | Name=AluSx |
| ADediting_1431405 | chr9_111627406_- | SINE | Alu | Name=AluSx |
Top |
RNA A-to-I editing events in the alternative splicing sites for LRRC37A5P |
| RNA A-to-I editing(s) in the alternative splicing sites. |
| AStype | ADeditomID | Editing position | AS position | AS direction | Exonic location | Wildtype sequence | Wildtype splicing strength | RNA edited sequence | RNA edited splicing strength |
| A3SS | ADediting_1431398 | chr9_111627251_- | 111627233:111627255 | 3ss | 16i | TCTCAAACTCCTGACCTCAGGTG | 6.21 | TCTCGAACTCCTGACCTCAGGTG | 5.92 |
| A3SS | ADediting_1431400 | chr9_111627291_- | 111627287:111627309 | 3ss | 2i | GCTAATGTTTGTATTTTCAGTGG | 5.57 | GCTAATGTTTGTATTTTCGGTGG | -2.38 |
| A3SS | ADediting_1431400 | chr9_111627291_- | 111627287:111627309 | 3ss | 2i | GCTAATGTTTGTATTTTCAGTGG | 5.57 | GCTAATGTTTGTATTTTCGGTGG | -2.38 |
| A3SS | ADediting_1431401 | chr9_111627297_- | 111627287:111627309 | 3ss | 8i | GCTAATGTTTGTATTTTCAGTGG | 5.57 | GCTAATGTTTGTGTTTTCAGTGG | 6.28 |
| A3SS | ADediting_1431401 | chr9_111627297_- | 111627287:111627309 | 3ss | 8i | GCTAATGTTTGTATTTTCAGTGG | 5.57 | GCTAATGTTTGTGTTTTCAGTGG | 6.28 |
| A3SS | ADediting_1431402 | chr9_111627305_- | 111627287:111627309 | 3ss | 16i | GCTAATGTTTGTATTTTCAGTGG | 5.57 | GCTAGTGTTTGTATTTTCAGTGG | 4.40 |
| Differential pencent of spliced in (PSI) between RNA A-to-I edited and non-edited samples |
Top |
Differntial gene expression between RNA A-to-I edited versus non-edited samples for LRRC37A5P |
| Distribution of the averaged gene expression in AD and control with or without RNA A-to-I editing event. * The grey color means N/A. |
| Distribution of the averaged gene isoform expression in AD and control with or without RNA A-to-I editing event. |
 | |
| - Differentially expressed gene between RNA A-to-I edited samples versus non-edited samples. * Click on the image to enlarge it in a new window. |
 |
 |
 |
 |
| - Differentially expressed transcript between RNA A-to-I edited samples versus non-edited samples. * Click on the image to enlarge it in a new window. |
 |
 |
| ADeditome ID | Chr | Positoing | Skipped exon | ENSG | ENSTs |
Top |
Protein coding region RNA A-to-I editings for LRRC37A5P |
| - Lollipop plot for RNA A-to-I editings across protein structure. * Click on the image to enlarge it in a new window. |
Top |
The effects of the RNA editing to the miRNA binding sites for LRRC37A5P |
| RNA A-to-I editing in the 3'-UTR regions of mRNA gained miRNA binding sites. |
| ADeditom_ID | Position | ENSG | ENST | Transcript name | miRNA ID | Chromosome | Targt | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
| RNA A-to-I editing in the 3'-UTR regions of mRNA lost miRNA binding sites. |
| ADeditom_ID | Position | ENSG | ENST | Transcript name | miRNA ID | Chromosome | Targt | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
| RNA A-to-I editing in lncRNA gained miRNA binding sites. |
| ADeditom_ID | Position | ENSG | ENST | Transcript name | miRNA ID | Chromosome | Targt | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
| RNA A-to-I editing in lncRNA lost miRNA binding sites. |
| ADeditom_ID | Position | ENSG | ENST | Transcript name | miRNA ID | Chromosome | Targt | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
| RNA A-to-I editing in miRNAs gained binding to lncRNA. |
| ADeditom_ID | Position | ENSG | ENST | Transcript name | miRNA ID | Chromosome | Targt | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
| RNA A-to-I editing in miRNAs lost binding to lncRNA. |
| ADeditom_ID | Position | ENSG | ENST | Transcript name | miRNA ID | Chromosome | Targt | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
| RNA A-to-I editing in miRNAs gained binding to the 3'-UTR region of mRNA. |
| ADeditom_ID | Position | ENSG | ENST | Transcript name | miRNA ID | Chromosome | Targt | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
| RNA A-to-I editing in miRNAs lost binding to the 3'-UTR mRNA. |
| ADeditom_ID | Position | ENSG | ENST | Transcript name | miRNA ID | Chromosome | Targt | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
| Differentially expressed gene-miRNA network |
Top |
The effects of the RNA editing to the stability of the RNA structures for LRRC37A5P |
| - RNA A-to-I editing in mRNA. * Click on the image to enlarge it in a new window. |
| ENST | ENST type | RNA structure without RNA A-to-I editing. | RNA structure with RNA A-to-I editing. |
| RNA A-to-I editing in miRNA. |
| ADeditom_ID | ENST | mir_ID | Editing_Information | Editing_Position | MFE_withoneAI | MFE_withoutAI | MFE_withmultipleAI |
| RNA A-to-I editing in mRNA. |
| ADeditom_ID | ENST | Editing_Information | Editing_Position | MFE_withoneAI | MFE_withoutAI | MFE_withmultipleAI |
| RNA A-to-I editing in lncRNA. |
| ADeditom_ID | ENST | Editing_Information | Editing_Position | MFE_withoneAI | MFE_withoutAI | MFE_withmultipleAI |
Top |
Relation with ADAR for LRRC37A5P |
| Correlation between ADAR gene expression and RNA editing frequency |
| Tissue | ADeditomID | position | ADAR1 (p-val) | ADAR1 (coeff.) | ADAR2 (p-val) | ADAR2 (coeff.) | ADAR3 (p-val) | ADAR3 (coeff.) |
| Correlation between ADAR gene expression and this gene's expression |
| Tissue | ADAR1 (p-val) | ADAR1 (coeff.) | ADAR2 (p-val) | ADAR2 (coeff.) | ADAR3 (p-val) | ADAR3 (coeff.) |
| AC | 3.85857815165742e-12 | 0.420637072044097 | 2.83727144265782e-05 | 0.26144607621455 | 4.37268469546974e-22 | 0.560532076901625 |
| CER | 0.144900703054586 | 0.119600219979969 | 0.0175414895668363 | 0.193710625300122 | 8.40594771031046e-06 | 0.354779631063402 |
| IFG | 0.0907727123412244 | 0.345448117141335 | 0.0639080783958336 | 0.376080496317804 | 0.0494180193640863 | 0.396996395489087 |
| STG | 0.817925867001362 | -0.0254963045819443 | 0.317951201033968 | -0.110284252738696 | 0.00473846696595472 | 0.305335534791739 |
Top |
Relation with AD stages for LRRC37A5P |
| Correlation between AD stages and RNA editing frequency |
| Tissue | ADeditomID | position | P-val | Coeff. |
| Correlation between AD stages and this gene's expression |
| Tissue | P-val | Coeff. |
Top |
RelatedDrugs for LRRC37A5P |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for LRRC37A5P |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|