|
||||||
|
 | |
| |
| Differntial gene expression between RNA A-to-I edited versus non-edited samples |
| |
| |
| The effects of the RNA editing to the stability of the RNA structures |
| |
| |
| |
|
Gene summary for MAP4K1 |
 Gene summary |
| Gene information | Gene symbol | MAP4K1 | Gene ID | 11184 |
| Gene name | mitogen-activated protein kinase kinase kinase kinase 1 | |
| Synonyms | HPK1 | |
| Cytomap | 19q13.2 | |
| Type of gene | protein-coding | |
| Description | mitogen-activated protein kinase kinase kinase kinase 1MAPK/ERK kinase kinase kinase 1MEK kinase kinase 1MEKKK 1hematopoietic progenitor kinase 1 | |
| Modification date | 20200327 | |
| UniProtAcc | Q92918, | |
| Context |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| MAP4K1 | GO:0006468 | protein phosphorylation | 8824585 |
| MAP4K1 | GO:0007257 | activation of JUN kinase activity | 8824585 |
| MAP4K1 | GO:0018105 | peptidyl-serine phosphorylation | 11053428|24362026 |
| MAP4K1 | GO:0046777 | protein autophosphorylation | 8824585|24362026 |
| MAP4K1 | GO:1904628 | cellular response to phorbol 13-acetate 12-myristate | 8824585 |
Top |
RNA A-to-I events for MAP4K1 |
| RNA A-to-I editing events in the ROSMAP, MSBB, and Mayo data sets based on Ensembl gene isoform structure. * This pie chart shows the number of RNA A-to-I editing events in different types of transcripts (# event, percentage). |
 |
| RNA editing frequencies across three data sets. |
| The number of RNA A-to-I editing events in different types of transcripts (# event, percentage). |
 |
| RNA A-to-I editing events in AD. |
| ADediting_748611(38589203, -), ADediting_748612(38589216, -), ADediting_748613(38589217, -), ADediting_748614(38589220, -), ADediting_748615(38589221, -), ADediting_748616(38589227, -), ADediting_748617(38589259, -), ADediting_748618(38589289, -), ADediting_748619(38589481, -), ADediting_748620(38589492, -), ADediting_748621(38589553, -), ADediting_748622(38589554, -), ADediting_748623(38589572, -), ADediting_748624(38589842, -), ADediting_748644(38615914, -), |
Top |
RNA editing positional annotations for MAP4K1 using Annovar |
| Protein coding RNA editing(s). |
| ADeditome ID | Position | Variant type | ENST | NTchange | AAchange | SIFT_score | Polyphen2_HVAR_score | PROVEAN_pred |
| ADediting_748611 | chr19_38589203_- | synonymous SNV | ENST00000591517.5 | c.A2469G | p.S823S | . | . | . |
| ADediting_748612 | chr19_38589216_- | nonsynonymous SNV | ENST00000591517.5 | c.A2456G | p.N819S | . | . | . |
| ADediting_748613 | chr19_38589217_- | nonsynonymous SNV | ENST00000591517.5 | c.A2455G | p.N819D | . | . | . |
| ADediting_748614 | chr19_38589220_- | nonsynonymous SNV | ENST00000591517.5 | c.A2452G | p.S818G | . | . | . |
| ADediting_748615 | chr19_38589221_- | synonymous SNV | ENST00000591517.5 | c.A2451G | p.S817S | . | . | . |
| ADediting_748616 | chr19_38589227_- | synonymous SNV | ENST00000591517.5 | c.A2445G | p.P815P | . | . | . |
| ADediting_748617 | chr19_38589259_- | nonsynonymous SNV | ENST00000591517.5 | c.A2413G | p.T805A | . | . | . |
| Gene structure information of RNA editing(s). |
| ADeditome ID | Position | Variant type |
| ADediting_748611 | chr19_38589203_- | exonic |
| ADediting_748612 | chr19_38589216_- | exonic |
| ADediting_748613 | chr19_38589217_- | exonic |
| ADediting_748614 | chr19_38589220_- | exonic |
| ADediting_748615 | chr19_38589221_- | exonic |
| ADediting_748616 | chr19_38589227_- | exonic |
| ADediting_748617 | chr19_38589259_- | exonic |
| ADediting_748618 | chr19_38589289_- | intronic |
| ADediting_748619 | chr19_38589481_- | intronic |
| ADediting_748620 | chr19_38589492_- | intronic |
| ADediting_748621 | chr19_38589553_- | intronic |
| ADediting_748622 | chr19_38589554_- | intronic |
| ADediting_748623 | chr19_38589572_- | intronic |
| ADediting_748624 | chr19_38589842_- | intronic |
| ADediting_748644 | chr19_38615914_- | intronic |
| Repat-regional RNA editing(s). |
| ADeditome ID | Position | Repeat family | Repeat sub family | Repeat name |
| ADediting_748611 | chr19_38589203_- | SINE | Alu | Name=AluSx |
| ADediting_748612 | chr19_38589216_- | SINE | Alu | Name=AluSx |
| ADediting_748613 | chr19_38589217_- | SINE | Alu | Name=AluSx |
| ADediting_748614 | chr19_38589220_- | SINE | Alu | Name=AluSx |
| ADediting_748615 | chr19_38589221_- | SINE | Alu | Name=AluSx |
| ADediting_748616 | chr19_38589227_- | SINE | Alu | Name=AluSx |
| ADediting_748617 | chr19_38589259_- | SINE | Alu | Name=AluSx |
| ADediting_748618 | chr19_38589289_- | SINE | Alu | Name=AluSx |
| ADediting_748619 | chr19_38589481_- | SINE | Alu | Name=AluSp |
| ADediting_748620 | chr19_38589492_- | SINE | Alu | Name=AluSp |
| ADediting_748621 | chr19_38589553_- | SINE | Alu | Name=AluSp |
| ADediting_748622 | chr19_38589554_- | SINE | Alu | Name=AluSp |
| ADediting_748623 | chr19_38589572_- | SINE | Alu | Name=AluSp |
| ADediting_748624 | chr19_38589842_- | SINE | Alu | Name=AluJb |
| ADediting_748644 | chr19_38615914_- | SINE | Alu | Name=AluSx1 |
Top |
RNA A-to-I editing events in the alternative splicing sites for MAP4K1 |
| RNA A-to-I editing(s) in the alternative splicing sites. |
| AStype | ADeditomID | Editing position | AS position | AS direction | Exonic location | Wildtype sequence | Wildtype splicing strength | RNA edited sequence | RNA edited splicing strength |
| ES | ADediting_748618 | chr19_38589289_- | 38589273:38589295 | 3ss | 14i | AGTCTCACTCTGTCCCCCAGGCT | 7.07 | AGTCTCGCTCTGTCCCCCAGGCT | 7.81 |
| ME2 | ADediting_748618 | chr19_38589289_- | 38589273:38589295 | 3ss | 14i | AGTCTCACTCTGTCCCCCAGGCT | 7.07 | AGTCTCGCTCTGTCCCCCAGGCT | 7.81 |
| Differential pencent of spliced in (PSI) between RNA A-to-I edited and non-edited samples |
Top |
Differntial gene expression between RNA A-to-I edited versus non-edited samples for MAP4K1 |
| Distribution of the averaged gene expression in AD and control with or without RNA A-to-I editing event. * The grey color means N/A. |
| Distribution of the averaged gene isoform expression in AD and control with or without RNA A-to-I editing event. |
| - Differentially expressed gene between RNA A-to-I edited samples versus non-edited samples. * Click on the image to enlarge it in a new window. |
| - Differentially expressed transcript between RNA A-to-I edited samples versus non-edited samples. * Click on the image to enlarge it in a new window. |
| ADeditome ID | Chr | Positoing | Skipped exon | ENSG | ENSTs |
Top |
Protein coding region RNA A-to-I editings for MAP4K1 |
| - Lollipop plot for RNA A-to-I editings across protein structure. * Click on the image to enlarge it in a new window. |
 |
Top |
The effects of the RNA editing to the miRNA binding sites for MAP4K1 |
| RNA A-to-I editing in the 3'-UTR regions of mRNA gained miRNA binding sites. |
| ADeditom_ID | Position | ENSG | ENST | Transcript name | miRNA ID | Chromosome | Targt | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
| RNA A-to-I editing in the 3'-UTR regions of mRNA lost miRNA binding sites. |
| ADeditom_ID | Position | ENSG | ENST | Transcript name | miRNA ID | Chromosome | Targt | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
| RNA A-to-I editing in lncRNA gained miRNA binding sites. |
| ADeditom_ID | Position | ENSG | ENST | Transcript name | miRNA ID | Chromosome | Targt | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
| RNA A-to-I editing in lncRNA lost miRNA binding sites. |
| ADeditom_ID | Position | ENSG | ENST | Transcript name | miRNA ID | Chromosome | Targt | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
| RNA A-to-I editing in miRNAs gained binding to lncRNA. |
| ADeditom_ID | Position | ENSG | ENST | Transcript name | miRNA ID | Chromosome | Targt | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
| RNA A-to-I editing in miRNAs lost binding to lncRNA. |
| ADeditom_ID | Position | ENSG | ENST | Transcript name | miRNA ID | Chromosome | Targt | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
| RNA A-to-I editing in miRNAs gained binding to the 3'-UTR region of mRNA. |
| ADeditom_ID | Position | ENSG | ENST | Transcript name | miRNA ID | Chromosome | Targt | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
| ADediting_1631458 | chr19_40282624_- | ENSG00000104814.13 | ENST00000396857.7 | MAP4K1-201 | hsa-miR-641 | chr19 | 38587673 | 38587679 | 7mer-m8 | 38587672 | 38587693 | 149 | -15.18 |
| ADediting_1631458 | chr19_40282624_- | ENSG00000104814.13 | ENST00000586296.5 | MAP4K1-203 | hsa-miR-641 | chr19 | 38587673 | 38587679 | 7mer-m8 | 38587672 | 38587693 | 149 | -15.18 |
| ADediting_1631458 | chr19_40282624_- | ENSG00000104814.13 | ENST00000589130.5 | MAP4K1-208 | hsa-miR-641 | chr19 | 38587673 | 38587679 | 7mer-m8 | 38587672 | 38587693 | 149 | -15.18 |
| ADediting_1631458 | chr19_40282624_- | ENSG00000104814.13 | ENST00000591517.5 | MAP4K1-210 | hsa-miR-641 | chr19 | 38587673 | 38587679 | 7mer-m8 | 38587672 | 38587693 | 149 | -15.18 |
| RNA A-to-I editing in miRNAs lost binding to the 3'-UTR mRNA. |
| ADeditom_ID | Position | ENSG | ENST | Transcript name | miRNA ID | Chromosome | Targt | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
| Differentially expressed gene-miRNA network |
Top |
The effects of the RNA editing to the stability of the RNA structures for MAP4K1 |
| - RNA A-to-I editing in mRNA. * Click on the image to enlarge it in a new window. |
| ENST | ENST type | RNA structure without RNA A-to-I editing. | RNA structure with RNA A-to-I editing. |
| ENST00000591517.5 | protein_coding |  |  |
| RNA A-to-I editing in miRNA. |
| ADeditom_ID | ENST | mir_ID | Editing_Information | Editing_Position | MFE_withoneAI | MFE_withoutAI | MFE_withmultipleAI |
| RNA A-to-I editing in mRNA. |
| ADeditom_ID | ENST | Editing_Information | Editing_Position | MFE_withoneAI | MFE_withoutAI | MFE_withmultipleAI |
| ADediting_748611 | ENST00000591517.5 | chr19_38589203_- | 2498 | -1070.00 | -1069.40 | -1083.30 |
| ADediting_748612 | ENST00000591517.5 | chr19_38589216_- | 2485 | -1071.70 | -1069.40 | -1083.30 |
| ADediting_748613 | ENST00000591517.5 | chr19_38589217_- | 2484 | -1069.40 | -1069.40 | -1083.30 |
| ADediting_748614 | ENST00000591517.5 | chr19_38589220_- | 2481 | -1072.00 | -1069.40 | -1083.30 |
| ADediting_748615 | ENST00000591517.5 | chr19_38589221_- | 2480 | -1069.10 | -1069.40 | -1083.30 |
| ADediting_748616 | ENST00000591517.5 | chr19_38589227_- | 2474 | -1072.80 | -1069.40 | -1083.30 |
| ADediting_748617 | ENST00000591517.5 | chr19_38589259_- | 2442 | -1073.80 | -1069.40 | -1083.30 |
| RNA A-to-I editing in lncRNA. |
| ADeditom_ID | ENST | Editing_Information | Editing_Position | MFE_withoneAI | MFE_withoutAI | MFE_withmultipleAI |
Top |
Relation with ADAR for MAP4K1 |
| Correlation between ADAR gene expression and RNA editing frequency |
| Tissue | ADeditomID | position | ADAR1 (p-val) | ADAR1 (coeff.) | ADAR2 (p-val) | ADAR2 (coeff.) | ADAR3 (p-val) | ADAR3 (coeff.) |
| Correlation between ADAR gene expression and this gene's expression |
| Tissue | ADAR1 (p-val) | ADAR1 (coeff.) | ADAR2 (p-val) | ADAR2 (coeff.) | ADAR3 (p-val) | ADAR3 (coeff.) |
| DLPFC | 0.00096883617710143 | 0.18650126866021 | 1.00311465896981e-05 | 0.2479151081601 | 6.30261052090464e-23 | 0.520552267746049 |
| AC | 8.75392286289874e-11 | 0.39541569774215 | 1.01048967946612e-07 | 0.328998574125861 | 2.63269905241344e-05 | 0.262468223007826 |
| FP | 1.36087905825782e-05 | 0.319706059145583 | 0.000153969418593782 | 0.279945392950265 | 0.0042710610788653 | 0.213206306567777 |
| IFG | 0.00162552688114255 | 0.597108407819588 | 3.63595296889241e-05 | 0.728536399045381 | 0.012827555474638 | 0.490353982452741 |
| STG | 0.0235045052305715 | 0.247004479178422 | 0.919203980953492 | 0.0112356330741741 | 0.00137246916164007 | 0.343639999955778 |
Top |
Relation with AD stages for MAP4K1 |
| Correlation between AD stages and RNA editing frequency |
| Tissue | ADeditomID | position | P-val | Coeff. |
| Correlation between AD stages and this gene's expression |
| Tissue | P-val | Coeff. |
Top |
RelatedDrugs for MAP4K1 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
| MAP4K1 | Q92918 | DB12010 | Fostamatinib | Mitogen-activated protein kinase kinase kinase kinase 1 | small molecule | approved|investigational |
Top |
RelatedDiseases for MAP4K1 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|