|
||||||
|
 | |
| |
| Differntial gene expression between RNA A-to-I edited versus non-edited samples |
| |
| |
| The effects of the RNA editing to the stability of the RNA structures |
| |
| |
| |
|
Gene summary for LINC01273 |
 Gene summary |
| Gene information | Gene symbol | LINC01273 | Gene ID | 101927541 |
| Gene name | long intergenic non-protein coding RNA 1273 | |
| Synonyms | - | |
| Cytomap | 20q13.13 | |
| Type of gene | ncRNA | |
| Description | - | |
| Modification date | 20200313 | |
| UniProtAcc | ||
| Context |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
RNA A-to-I events for LINC01273 |
| RNA A-to-I editing events in the ROSMAP, MSBB, and Mayo data sets based on Ensembl gene isoform structure. * This pie chart shows the number of RNA A-to-I editing events in different types of transcripts (# event, percentage). |
 |
| RNA editing frequencies across three data sets. |
| The number of RNA A-to-I editing events in different types of transcripts (# event, percentage). |
 |
| RNA A-to-I editing events in AD. |
| ADediting_943985(50173200, +), ADediting_943986(50173207, +), ADediting_943987(50173250, +), ADediting_943988(50173255, +), ADediting_943989(50173293, +), ADediting_943990(50173315, +), ADediting_943991(50173317, +), ADediting_943992(50173416, +), ADediting_943993(50173443, +), ADediting_943994(50174058, +), ADediting_943995(50174067, +), ADediting_943996(50174152, +), ADediting_943997(50174636, +), ADediting_943998(50175770, +), |
Top |
RNA editing positional annotations for LINC01273 using Annovar |
| Protein coding RNA editing(s). |
| ADeditome ID | Position | Variant type | ENST | NTchange | AAchange | SIFT_score | Polyphen2_HVAR_score | PROVEAN_pred |
| Gene structure information of RNA editing(s). |
| ADeditome ID | Position | Variant type |
| ADediting_943985 | chr20_50173200_+ | ncRNA_exonic;splicing |
| ADediting_943986 | chr20_50173207_+ | ncRNA_exonic |
| ADediting_943987 | chr20_50173250_+ | ncRNA_exonic |
| ADediting_943988 | chr20_50173255_+ | ncRNA_exonic |
| ADediting_943989 | chr20_50173293_+ | ncRNA_exonic |
| ADediting_943990 | chr20_50173315_+ | ncRNA_exonic |
| ADediting_943991 | chr20_50173317_+ | ncRNA_exonic |
| ADediting_943992 | chr20_50173416_+ | ncRNA_exonic |
| ADediting_943993 | chr20_50173443_+ | ncRNA_exonic |
| ADediting_943994 | chr20_50174058_+ | ncRNA_intronic |
| ADediting_943995 | chr20_50174067_+ | ncRNA_intronic |
| ADediting_943996 | chr20_50174152_+ | ncRNA_intronic |
| ADediting_943997 | chr20_50174636_+ | ncRNA_intronic |
| ADediting_943998 | chr20_50175770_+ | ncRNA_intronic |
| Repat-regional RNA editing(s). |
| ADeditome ID | Position | Repeat family | Repeat sub family | Repeat name |
| ADediting_943985 | chr20_50173200_+ | SINE | Alu | Name=AluJo |
| ADediting_943986 | chr20_50173207_+ | SINE | Alu | Name=AluJo |
| ADediting_943987 | chr20_50173250_+ | SINE | Alu | Name=AluJo |
| ADediting_943988 | chr20_50173255_+ | SINE | Alu | Name=AluJo |
| ADediting_943989 | chr20_50173293_+ | SINE | Alu | Name=AluJo |
| ADediting_943990 | chr20_50173315_+ | SINE | Alu | Name=AluJo |
| ADediting_943991 | chr20_50173317_+ | SINE | Alu | Name=AluJo |
| ADediting_943992 | chr20_50173416_+ | SINE | Alu | Name=AluJo |
| ADediting_943993 | chr20_50173443_+ | SINE | Alu | Name=AluJo |
| ADediting_943994 | chr20_50174058_+ | SINE | Alu | Name=AluSx1 |
| ADediting_943995 | chr20_50174067_+ | SINE | Alu | Name=AluSx1 |
| ADediting_943996 | chr20_50174152_+ | SINE | Alu | Name=AluSx1 |
| ADediting_943997 | chr20_50174636_+ | SINE | Alu | Name=AluJo |
| ADediting_943998 | chr20_50175770_+ | SINE | Alu | Name=AluSx1 |
Top |
RNA A-to-I editing events in the alternative splicing sites for LINC01273 |
| RNA A-to-I editing(s) in the alternative splicing sites. |
| AStype | ADeditomID | Editing position | AS position | AS direction | Exonic location | Wildtype sequence | Wildtype splicing strength | RNA edited sequence | RNA edited splicing strength |
| RI | ADediting_943985 | chr20_50173200_+ | 50173182:50173204 | 3ss | 2i | TCTTTGTTTTTTGTGACAAGGTC | 6.66 | TCTTTGTTTTTTGTGACAGGGTC | -1.30 |
| Differential pencent of spliced in (PSI) between RNA A-to-I edited and non-edited samples |
Top |
Differntial gene expression between RNA A-to-I edited versus non-edited samples for LINC01273 |
| Distribution of the averaged gene expression in AD and control with or without RNA A-to-I editing event. * The grey color means N/A. |
| Distribution of the averaged gene isoform expression in AD and control with or without RNA A-to-I editing event. |
 | |
 | |
 | |
 | |
 | |
 | |
 | |
| - Differentially expressed gene between RNA A-to-I edited samples versus non-edited samples. * Click on the image to enlarge it in a new window. |
 |
 |
 |
 |
 |
| - Differentially expressed transcript between RNA A-to-I edited samples versus non-edited samples. * Click on the image to enlarge it in a new window. |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
| ADeditome ID | Chr | Positoing | Skipped exon | ENSG | ENSTs |